Mutagenetix > Incidental Mutation

Incidental Mutation 'R6657:Eml5'

526677

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

044778-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 98791405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1843 (I1843L)

Ref Sequence

ENSEMBL: ENSMUSP00000065643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000065716] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably benign
Transcript: ENSMUST00000021399

SMART Domains

Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
coiled coil region	69	91	N/A	INTRINSIC
ZnF_C3H1	170	193	7.16e-1	SMART
ZnF_C3H1	195	214	5.27e1	SMART
ZnF_C3H1	250	272	5.55e0	SMART
Pfam:zf-CCCH_2	273	290	1.3e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000057000

SMART Domains

Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	440	463	7.16e-1	SMART
ZnF_C3H1	465	484	5.27e1	SMART
ZnF_C3H1	520	542	5.55e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: I1843L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: I1843L

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110104

SMART Domains

Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	465	488	7.16e-1	SMART
ZnF_C3H1	490	509	5.27e1	SMART
ZnF_C3H1	545	567	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110105

SMART Domains

Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	596	619	7.16e-1	SMART
ZnF_C3H1	621	640	5.27e1	SMART
ZnF_C3H1	676	698	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220848

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221107

Predicted Effect

probably benign
Transcript: ENSMUST00000221532

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221902

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223282
AA Change: I1890L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000222097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222146

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222461

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGTTAGAACTGCAACGTTC -3'
(R):5'- CATGGCTCAACAAGTTCTTGAGAAG -3'

Sequencing Primer
(F):5'- GAGGGTGACTCATCTAAGATTCAAC -3'
(R):5'- ATAATGACCTTGAAGATTTCAGGCAC -3'

Posted On

2018-07-23