Incidental Mutation 'R6657:Sfmbt1'
ID 526678
Institutional Source Beutler Lab
Gene Symbol Sfmbt1
Ensembl Gene ENSMUSG00000006527
Gene Name Scm-like with four mbt domains 1
Synonyms 4930442N21Rik, 9330180L21Rik, Smr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 30714849-30822721 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30766096 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 8 (D8G)
Ref Sequence ENSEMBL: ENSMUSP00000153962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054230] [ENSMUST00000112184] [ENSMUST00000227201] [ENSMUST00000227303] [ENSMUST00000228006]
AlphaFold Q9JMD1
Predicted Effect probably benign
Transcript: ENSMUST00000054230
AA Change: D8G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056744
Gene: ENSMUSG00000006527
AA Change: D8G

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112184
AA Change: D8G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107802
Gene: ENSMUSG00000006527
AA Change: D8G

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 499 614 3.1e-41 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227201
AA Change: D8G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227303
AA Change: D8G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227408
Predicted Effect probably benign
Transcript: ENSMUST00000228006
AA Change: D8G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares high similarity with the Drosophila Scm (sex comb on midleg) gene. It encodes a protein which contains four malignant brain tumor repeat (mbt) domains and may be involved in antigen recognition. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Sfmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Sfmbt1 APN 14 30810311 missense probably damaging 1.00
IGL01351:Sfmbt1 APN 14 30769820 missense probably benign 0.00
IGL01478:Sfmbt1 APN 14 30811521 missense probably damaging 1.00
IGL01632:Sfmbt1 APN 14 30817712 missense probably damaging 1.00
IGL02252:Sfmbt1 APN 14 30817733 missense probably damaging 1.00
IGL02456:Sfmbt1 APN 14 30785880 missense probably damaging 0.99
IGL02651:Sfmbt1 APN 14 30815537 missense probably damaging 1.00
IGL02967:Sfmbt1 APN 14 30816802 missense probably damaging 1.00
PIT4142001:Sfmbt1 UTSW 14 30816757 splice site probably null
PIT4519001:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
PIT4531001:Sfmbt1 UTSW 14 30796326 missense probably benign 0.00
R0043:Sfmbt1 UTSW 14 30816807 missense probably damaging 0.99
R0389:Sfmbt1 UTSW 14 30811507 missense probably damaging 1.00
R0395:Sfmbt1 UTSW 14 30787617 splice site probably benign
R0562:Sfmbt1 UTSW 14 30811373 splice site probably null
R1083:Sfmbt1 UTSW 14 30787541 missense possibly damaging 0.92
R1900:Sfmbt1 UTSW 14 30802567 missense probably damaging 1.00
R2447:Sfmbt1 UTSW 14 30773893 missense possibly damaging 0.62
R3104:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3105:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3106:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R4038:Sfmbt1 UTSW 14 30787492 missense probably damaging 1.00
R5118:Sfmbt1 UTSW 14 30790770 missense probably damaging 1.00
R5227:Sfmbt1 UTSW 14 30815254 critical splice donor site probably null
R5286:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5287:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5295:Sfmbt1 UTSW 14 30774029 missense probably damaging 1.00
R5620:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
R6113:Sfmbt1 UTSW 14 30815184 missense possibly damaging 0.68
R6139:Sfmbt1 UTSW 14 30811418 missense probably damaging 1.00
R6429:Sfmbt1 UTSW 14 30773911 missense probably damaging 1.00
R6955:Sfmbt1 UTSW 14 30766034 start gained probably benign
R6957:Sfmbt1 UTSW 14 30787589 missense probably benign 0.00
R7206:Sfmbt1 UTSW 14 30811373 splice site probably null
R7337:Sfmbt1 UTSW 14 30784739 missense possibly damaging 0.62
R7451:Sfmbt1 UTSW 14 30816811 missense probably benign 0.02
R7684:Sfmbt1 UTSW 14 30810354 missense probably damaging 1.00
R7798:Sfmbt1 UTSW 14 30816802 missense probably damaging 1.00
R7983:Sfmbt1 UTSW 14 30797716 splice site probably null
R8468:Sfmbt1 UTSW 14 30773984 missense probably benign
R9342:Sfmbt1 UTSW 14 30797642 missense possibly damaging 0.94
X0064:Sfmbt1 UTSW 14 30815205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCAGTCAAATGCTGTCTTATG -3'
(R):5'- AAACAGTAGTGTAGTCCCTAGTGC -3'

Sequencing Primer
(F):5'- CTGGACAGAAACTTGACG -3'
(R):5'- TAGTGCCAAGTTGTAACGCC -3'
Posted On 2018-07-23