Incidental Mutation 'R6657:Psmb5'
ID 526680
Institutional Source Beutler Lab
Gene Symbol Psmb5
Ensembl Gene ENSMUSG00000022193
Gene Name proteasome (prosome, macropain) subunit, beta type 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R6657 (G1)
Quality Score 210.009
Status Validated
Chromosome 14
Chromosomal Location 54614119-54618022 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54614383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 115 (Y115H)
Ref Sequence ENSEMBL: ENSMUSP00000154672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022803] [ENSMUST00000227257]
AlphaFold O55234
Predicted Effect probably benign
Transcript: ENSMUST00000022803
AA Change: Y202H

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022803
Gene: ENSMUSG00000022193
AA Change: Y202H

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
Pfam:Proteasome 56 238 8.3e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102174
Predicted Effect possibly damaging
Transcript: ENSMUST00000227257
AA Change: Y115H

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.4507 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Psmb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Psmb5 APN 14 54617807 missense possibly damaging 0.85
IGL02967:Psmb5 APN 14 54616626 missense probably benign 0.11
IGL03095:Psmb5 APN 14 54616557 missense probably damaging 1.00
R2447:Psmb5 UTSW 14 54614470 missense probably damaging 0.97
R5651:Psmb5 UTSW 14 54616764 missense possibly damaging 0.64
R6346:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6372:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6687:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6688:Psmb5 UTSW 14 54616673 missense probably damaging 0.98
R6752:Psmb5 UTSW 14 54616755 missense probably benign 0.00
R7007:Psmb5 UTSW 14 54616709 missense probably damaging 0.99
R7801:Psmb5 UTSW 14 54616755 missense probably benign 0.00
R8066:Psmb5 UTSW 14 54614241 missense probably benign 0.00
R8278:Psmb5 UTSW 14 54617885 missense probably benign 0.13
R8497:Psmb5 UTSW 14 54614380 missense possibly damaging 0.95
R8728:Psmb5 UTSW 14 54617804 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGTACTTGTCATGTAAGTCAGC -3'
(R):5'- GTGCTCTGGAATCTGGAAATCTCA -3'

Sequencing Primer
(F):5'- AGTCAGCTACATTGTCACTGGAC -3'
(R):5'- TGGACCTCACTTTGTAGACCAGG -3'
Posted On 2018-07-23