Mutagenetix > Incidental Mutations

Incidental Mutation 'R6657:Gpc5'

526682

Institutional Source

Beutler Lab

Gene Symbol

Gpc5

Ensembl Gene

ENSMUSG00000022112

Gene Name

glypican 5

Synonyms

A230034F01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115092215-116525179 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115370198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 404 (H404R)

Ref Sequence

ENSEMBL: ENSMUSP00000135085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000175665] [ENSMUST00000176912]

AlphaFold

Q8CAL5

Predicted Effect

probably benign
Transcript: ENSMUST00000022707
AA Change: H331R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: H331R

Domain	Start	End	E-Value	Type
Pfam:Glypican	9	572	1.8e-182	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175665
AA Change: H404R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000135857
Gene: ENSMUSG00000022112
AA Change: H404R

Domain	Start	End	E-Value	Type
Pfam:Glypican	82	480	1.3e-142	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176912
AA Change: H404R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: H404R

Domain	Start	End	E-Value	Type
Pfam:Glypican	85	642	1.6e-174	PFAM

Meta Mutation Damage Score

0.0855

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Gpc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Gpc5	APN	14	115370024	missense	probably damaging	1.00
IGL01298:Gpc5	APN	14	115399188	missense	probably benign	0.14
IGL01359:Gpc5	APN	14	115369750	missense	possibly damaging	0.74
IGL02354:Gpc5	APN	14	115133287	nonsense	probably null
IGL02361:Gpc5	APN	14	115133287	nonsense	probably null
IGL02982:Gpc5	APN	14	115369988	missense	probably damaging	1.00
IGL03120:Gpc5	APN	14	115370144	missense	possibly damaging	0.64
R0322:Gpc5	UTSW	14	115399151	missense	probably benign	0.05
R0396:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R0555:Gpc5	UTSW	14	115552328	missense	probably damaging	0.98
R0629:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R1536:Gpc5	UTSW	14	115399250	missense	probably benign	0.09
R1660:Gpc5	UTSW	14	115399279	missense	probably benign	0.12
R1676:Gpc5	UTSW	14	115370098	missense	probably damaging	1.00
R2328:Gpc5	UTSW	14	115788179	missense	probably damaging	0.99
R3522:Gpc5	UTSW	14	116524335	missense	probably benign	0.00
R3776:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3885:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3889:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3893:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R4041:Gpc5	UTSW	14	115133216	missense	probably damaging	1.00
R4517:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R5068:Gpc5	UTSW	14	115417264	makesense	probably null
R5639:Gpc5	UTSW	14	115092747	missense	probably benign	0.13
R5730:Gpc5	UTSW	14	115788314	missense	possibly damaging	0.73
R5944:Gpc5	UTSW	14	115369838	missense	probably benign	0.24
R6351:Gpc5	UTSW	14	115399200	missense	probably benign	0.01
R6557:Gpc5	UTSW	14	115092534	unclassified	probably benign
R6714:Gpc5	UTSW	14	115552303	nonsense	probably null
R6751:Gpc5	UTSW	14	115369951	missense	probably benign	0.00
R7057:Gpc5	UTSW	14	115133242	missense	possibly damaging	0.64
R7142:Gpc5	UTSW	14	115417203	missense	probably benign	0.01
R7225:Gpc5	UTSW	14	115552298	missense	probably damaging	1.00
R7544:Gpc5	UTSW	14	115428173	missense	probably damaging	1.00
R7658:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R7695:Gpc5	UTSW	14	115092594	missense	unknown
R7785:Gpc5	UTSW	14	115417220	missense	probably benign	0.00
R8116:Gpc5	UTSW	14	115399225	missense	probably damaging	0.98
R8303:Gpc5	UTSW	14	115428255	missense	probably benign	0.01
R8983:Gpc5	UTSW	14	115092686	missense	unknown
RF001:Gpc5	UTSW	14	115417178	missense	probably benign	0.41
RF022:Gpc5	UTSW	14	115552276	missense	probably damaging	1.00
Z1176:Gpc5	UTSW	14	115369964	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGCCTCAATGTCATCAGGG -3'
(R):5'- TTTGGGGTAAAAGAGATGTAATGCC -3'

Sequencing Primer
(F):5'- TCAATGTCATCAGGGGCTGC -3'
(R):5'- GTAATGCCATACTTTGAATCCAGG -3'

Posted On

2018-07-23