Mutagenetix > Incidental Mutations

Incidental Mutation 'R6657:Kansl2'

526685

Institutional Source

Beutler Lab

Gene Symbol

Kansl2

Ensembl Gene

ENSMUSG00000022992

Gene Name

KAT8 regulatory NSL complex subunit 2

Synonyms

2310037I24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98517658-98534264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98524670 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 339 (Q339L)

Ref Sequence

ENSEMBL: ENSMUSP00000155089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023727] [ENSMUST00000116400] [ENSMUST00000230542] [ENSMUST00000231066]

Predicted Effect

probably benign
Transcript: ENSMUST00000023727
AA Change: Q339L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000023727
Gene: ENSMUSG00000022992
AA Change: Q339L

Domain	Start	End	E-Value	Type
Pfam:zf-C3Hc3H	27	93	4.8e-19	PFAM
Pfam:zf-C3Hc3H	300	365	4.6e-19	PFAM
low complexity region	408	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083402

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084005

Predicted Effect

possibly damaging
Transcript: ENSMUST00000116400
AA Change: Q339L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112101
Gene: ENSMUSG00000022992
AA Change: Q339L

Domain	Start	End	E-Value	Type
Pfam:zf-C3Hc3H	28	92	1e-19	PFAM
Pfam:zf-C3Hc3H	302	364	1.7e-16	PFAM
low complexity region	442	454	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229818

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230542
AA Change: Q339L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000231066

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Kansl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00822:Kansl2	APN	15	98528853	splice site	probably benign
IGL02167:Kansl2	APN	15	98533515	splice site	probably benign
IGL02349:Kansl2	APN	15	98529446	missense	probably damaging	1.00
R0004:Kansl2	UTSW	15	98520376	missense	probably damaging	1.00
R1128:Kansl2	UTSW	15	98533685	nonsense	probably null
R1129:Kansl2	UTSW	15	98533581	missense	probably damaging	1.00
R1311:Kansl2	UTSW	15	98528916	missense	possibly damaging	0.93
R2132:Kansl2	UTSW	15	98529397	missense	probably damaging	1.00
R2144:Kansl2	UTSW	15	98526631	missense	probably benign	0.00
R2232:Kansl2	UTSW	15	98524478	missense	probably damaging	1.00
R2510:Kansl2	UTSW	15	98528861	critical splice donor site	probably null
R3433:Kansl2	UTSW	15	98528861	critical splice donor site	probably null
R4125:Kansl2	UTSW	15	98531755	missense	possibly damaging	0.79
R4818:Kansl2	UTSW	15	98526661	missense	possibly damaging	0.48
R4906:Kansl2	UTSW	15	98531890	missense	possibly damaging	0.83
R4962:Kansl2	UTSW	15	98531843	missense	probably benign	0.01
R5973:Kansl2	UTSW	15	98529425	missense	probably damaging	1.00
R6014:Kansl2	UTSW	15	98520316	critical splice donor site	probably null
R6077:Kansl2	UTSW	15	98531431	missense	probably benign	0.08
R7168:Kansl2	UTSW	15	98529544	splice site	probably null
R7418:Kansl2	UTSW	15	98531894	missense	possibly damaging	0.95
R7530:Kansl2	UTSW	15	98529015	missense	probably benign	0.01
R7957:Kansl2	UTSW	15	98524618	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CAGAGCAGAGCTTCTCTAACTTAC -3'
(R):5'- ACTCCTGCAGTTGGCTTTCAG -3'

Sequencing Primer
(F):5'- ACTCCAGTGGTAAACTCTCAGTGG -3'
(R):5'- CCTGCAGTTGGCTTTCAGTAAAAATG -3'

Posted On

2018-07-23