Incidental Mutation 'R6657:Kansl2'
ID526685
Institutional Source Beutler Lab
Gene Symbol Kansl2
Ensembl Gene ENSMUSG00000022992
Gene NameKAT8 regulatory NSL complex subunit 2
Synonyms2310037I24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R6657 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98517658-98534264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98524670 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 339 (Q339L)
Ref Sequence ENSEMBL: ENSMUSP00000155089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023727] [ENSMUST00000116400] [ENSMUST00000230542] [ENSMUST00000231066]
Predicted Effect probably benign
Transcript: ENSMUST00000023727
AA Change: Q339L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023727
Gene: ENSMUSG00000022992
AA Change: Q339L

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 27 93 4.8e-19 PFAM
Pfam:zf-C3Hc3H 300 365 4.6e-19 PFAM
low complexity region 408 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084005
Predicted Effect possibly damaging
Transcript: ENSMUST00000116400
AA Change: Q339L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112101
Gene: ENSMUSG00000022992
AA Change: Q339L

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 28 92 1e-19 PFAM
Pfam:zf-C3Hc3H 302 364 1.7e-16 PFAM
low complexity region 442 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229818
Predicted Effect possibly damaging
Transcript: ENSMUST00000230542
AA Change: Q339L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000231066
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Kansl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Kansl2 APN 15 98528853 splice site probably benign
IGL02167:Kansl2 APN 15 98533515 splice site probably benign
IGL02349:Kansl2 APN 15 98529446 missense probably damaging 1.00
R0004:Kansl2 UTSW 15 98520376 missense probably damaging 1.00
R1128:Kansl2 UTSW 15 98533685 nonsense probably null
R1129:Kansl2 UTSW 15 98533581 missense probably damaging 1.00
R1311:Kansl2 UTSW 15 98528916 missense possibly damaging 0.93
R2132:Kansl2 UTSW 15 98529397 missense probably damaging 1.00
R2144:Kansl2 UTSW 15 98526631 missense probably benign 0.00
R2232:Kansl2 UTSW 15 98524478 missense probably damaging 1.00
R2510:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R3433:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R4125:Kansl2 UTSW 15 98531755 missense possibly damaging 0.79
R4818:Kansl2 UTSW 15 98526661 missense possibly damaging 0.48
R4906:Kansl2 UTSW 15 98531890 missense possibly damaging 0.83
R4962:Kansl2 UTSW 15 98531843 missense probably benign 0.01
R5973:Kansl2 UTSW 15 98529425 missense probably damaging 1.00
R6014:Kansl2 UTSW 15 98520316 critical splice donor site probably null
R6077:Kansl2 UTSW 15 98531431 missense probably benign 0.08
R7168:Kansl2 UTSW 15 98529544 splice site probably null
R7418:Kansl2 UTSW 15 98531894 missense possibly damaging 0.95
R7530:Kansl2 UTSW 15 98529015 missense probably benign 0.01
R7957:Kansl2 UTSW 15 98524618 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGAGCAGAGCTTCTCTAACTTAC -3'
(R):5'- ACTCCTGCAGTTGGCTTTCAG -3'

Sequencing Primer
(F):5'- ACTCCAGTGGTAAACTCTCAGTGG -3'
(R):5'- CCTGCAGTTGGCTTTCAGTAAAAATG -3'
Posted On2018-07-23