Incidental Mutation 'R6657:Itga5'
ID 526686
Institutional Source Beutler Lab
Gene Symbol Itga5
Ensembl Gene ENSMUSG00000000555
Gene Name integrin alpha 5 (fibronectin receptor alpha)
Synonyms Fnra, Cd49e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 103344286-103366763 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103350795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 735 (D735G)
Ref Sequence ENSEMBL: ENSMUSP00000023128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023128] [ENSMUST00000215331]
AlphaFold P11688
Predicted Effect probably damaging
Transcript: ENSMUST00000023128
AA Change: D735G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023128
Gene: ENSMUSG00000000555
AA Change: D735G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
Int_alpha 59 118 2.27e-8 SMART
Int_alpha 271 321 9.6e-7 SMART
Int_alpha 325 387 1.03e-15 SMART
Int_alpha 391 447 4.17e-16 SMART
Int_alpha 455 511 1.49e-3 SMART
SCOP:d1m1xa2 651 789 3e-44 SMART
SCOP:d1m1xa3 792 992 1e-62 SMART
transmembrane domain 1003 1025 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183535
Predicted Effect probably benign
Transcript: ENSMUST00000215331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230775
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain, which is proteolytically processed to generate light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signaling. Integrin alpha 5 and integrin alpha V chains are produced by distinct genes. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in posterior trunk and yolk sac mesodermal structures, lack of epithelialization of somites, reduced numbers of Schwann cells, and lethality around embryonic day 10-11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Itga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Itga5 APN 15 103350372 critical splice donor site probably null
IGL01102:Itga5 APN 15 103346675 missense probably benign 0.13
IGL01474:Itga5 APN 15 103354270 nonsense probably null
IGL01768:Itga5 APN 15 103351570 missense probably benign 0.34
IGL01832:Itga5 APN 15 103355949 nonsense probably null
IGL02188:Itga5 APN 15 103347717 missense probably benign 0.30
IGL02701:Itga5 APN 15 103347766 missense probably damaging 0.98
IGL02838:Itga5 APN 15 103351609 missense probably damaging 1.00
IGL02955:Itga5 APN 15 103350834 missense possibly damaging 0.48
R0617:Itga5 UTSW 15 103356315 critical splice donor site probably null
R0845:Itga5 UTSW 15 103350769 missense probably benign 0.07
R1210:Itga5 UTSW 15 103357473 missense possibly damaging 0.76
R1522:Itga5 UTSW 15 103356782 nonsense probably null
R1576:Itga5 UTSW 15 103351617 missense probably damaging 0.96
R1666:Itga5 UTSW 15 103347902 missense probably benign 0.00
R1808:Itga5 UTSW 15 103350399 missense probably damaging 1.00
R1836:Itga5 UTSW 15 103346014 missense probably damaging 1.00
R1964:Itga5 UTSW 15 103354314 missense probably damaging 1.00
R4290:Itga5 UTSW 15 103352257 critical splice donor site probably null
R4458:Itga5 UTSW 15 103350203 missense probably damaging 1.00
R4610:Itga5 UTSW 15 103350832 missense probably damaging 1.00
R4676:Itga5 UTSW 15 103357210 missense probably damaging 1.00
R4795:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4796:Itga5 UTSW 15 103347760 missense probably benign 0.05
R4837:Itga5 UTSW 15 103354084 missense probably damaging 0.99
R4929:Itga5 UTSW 15 103353235 missense probably benign 0.42
R5896:Itga5 UTSW 15 103351087 missense probably benign
R5947:Itga5 UTSW 15 103356785 missense probably damaging 1.00
R5957:Itga5 UTSW 15 103351429 missense probably benign 0.05
R6153:Itga5 UTSW 15 103357453 missense probably damaging 1.00
R6353:Itga5 UTSW 15 103352523 missense probably damaging 0.98
R6698:Itga5 UTSW 15 103351381 missense probably benign 0.15
R6891:Itga5 UTSW 15 103357543 missense probably damaging 1.00
R6981:Itga5 UTSW 15 103350226 missense probably benign 0.00
R7574:Itga5 UTSW 15 103350449 missense probably damaging 1.00
R7762:Itga5 UTSW 15 103349757 missense probably benign 0.01
R7813:Itga5 UTSW 15 103357314 critical splice acceptor site probably null
R7984:Itga5 UTSW 15 103355952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGATCTGAAAGTCAAACTGG -3'
(R):5'- GTACTCAGGACTTGTCAGACACC -3'

Sequencing Primer
(F):5'- CTGAAAGTCAAACTGGATGGTTTTC -3'
(R):5'- ACTTGTCAGACACCCAGGG -3'
Posted On 2018-07-23