Incidental Mutation 'R6658:Trim55'
ID 526699
Institutional Source Beutler Lab
Gene Symbol Trim55
Ensembl Gene ENSMUSG00000060913
Gene Name tripartite motif-containing 55
Synonyms Murf2, D830041C10Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6658 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 19698638-19746585 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19745719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 532 (R532C)
Ref Sequence ENSEMBL: ENSMUSP00000029139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139] [ENSMUST00000061294]
AlphaFold G3X8Y1
Predicted Effect probably damaging
Transcript: ENSMUST00000029139
AA Change: R532C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913
AA Change: R532C

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061294
SMART Domains Protein: ENSMUSP00000061185
Gene: ENSMUSG00000049796

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
CRF 146 185 1.55e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195674
Meta Mutation Damage Score 0.2531 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased heart and muscle to body weight ratios and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,077,353 (GRCm39) N1340S probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Antxr1 C A 6: 87,261,291 (GRCm39) R167L probably damaging Het
BC107364 T C 3: 96,348,026 (GRCm39) S88G unknown Het
Cfap100 T G 6: 90,390,400 (GRCm39) E80A probably damaging Het
Dhx8 C A 11: 101,655,748 (GRCm39) H1107Q probably damaging Het
Dip2c G A 13: 9,543,213 (GRCm39) probably null Het
Dpep2 A T 8: 106,716,542 (GRCm39) D212E probably benign Het
Dpep3 T C 8: 106,705,728 (GRCm39) T66A probably benign Het
Fat4 G T 3: 38,997,077 (GRCm39) M1765I probably benign Het
Gbgt1 G A 2: 28,394,998 (GRCm39) R212H probably benign Het
Gimap4 T C 6: 48,668,338 (GRCm39) S215P possibly damaging Het
Gpr161 A T 1: 165,134,136 (GRCm39) T133S possibly damaging Het
Grin2c G T 11: 115,149,108 (GRCm39) S163R possibly damaging Het
Grip2 T A 6: 91,763,472 (GRCm39) N109Y probably damaging Het
H60c G A 10: 3,210,270 (GRCm39) T93I possibly damaging Het
Hmgcl A G 4: 135,682,962 (GRCm39) N138S probably damaging Het
Hoxa3 G T 6: 52,147,058 (GRCm39) Y398* probably null Het
Igkv1-132 A G 6: 67,737,091 (GRCm39) N19S probably benign Het
Ikbip A G 10: 90,932,181 (GRCm39) N275S probably benign Het
Il7 T A 3: 7,642,239 (GRCm39) T33S probably benign Het
Iqgap2 A T 13: 95,796,840 (GRCm39) Y1105N probably damaging Het
Lmo7 A G 14: 102,148,281 (GRCm39) D934G possibly damaging Het
Mroh4 T C 15: 74,492,978 (GRCm39) Q310R possibly damaging Het
Mtmr14 C A 6: 113,242,437 (GRCm39) Y22* probably null Het
Muc5b G T 7: 141,422,244 (GRCm39) probably null Het
Naga T G 15: 82,214,975 (GRCm39) K328Q probably benign Het
Neo1 G A 9: 58,829,132 (GRCm39) T589I probably benign Het
Nme5 A C 18: 34,711,639 (GRCm39) I34S probably damaging Het
Nrip2 T C 6: 128,385,199 (GRCm39) L210P possibly damaging Het
Nup93 A G 8: 95,030,807 (GRCm39) D424G probably benign Het
Or12e9 T C 2: 87,202,497 (GRCm39) V207A probably benign Het
Or1e26 G A 11: 73,479,874 (GRCm39) S230F probably damaging Het
Papss1 T A 3: 131,311,696 (GRCm39) V308E probably benign Het
Pilrb1 T A 5: 137,855,789 (GRCm39) Y34F probably benign Het
Pira2 T A 7: 3,845,300 (GRCm39) E319D probably benign Het
Pkhd1 G A 1: 20,682,929 (GRCm39) T91M probably damaging Het
Prph2 A G 17: 47,230,790 (GRCm39) T228A probably benign Het
Ranbp17 G T 11: 33,169,214 (GRCm39) S1000* probably null Het
Rbm27 A C 18: 42,457,178 (GRCm39) H651P probably damaging Het
Scyl2 A T 10: 89,476,835 (GRCm39) D763E probably benign Het
Sltm A G 9: 70,488,644 (GRCm39) Y598C probably damaging Het
Smc2 A T 4: 52,451,322 (GRCm39) K322I probably benign Het
Tcf4 G A 18: 69,790,873 (GRCm39) R271Q probably null Het
Tex36 C T 7: 133,196,140 (GRCm39) D87N probably damaging Het
Tex44 A C 1: 86,354,751 (GRCm39) H220P probably benign Het
Tjp1 T C 7: 64,950,825 (GRCm39) D1683G possibly damaging Het
Trav7-2 T C 14: 53,628,573 (GRCm39) S104P probably damaging Het
Ube3c T A 5: 29,807,215 (GRCm39) L338Q probably damaging Het
Ush2a A G 1: 188,546,556 (GRCm39) H3444R possibly damaging Het
Vars1 A G 17: 35,234,717 (GRCm39) D1182G probably benign Het
Vit T A 17: 78,930,232 (GRCm39) I399N possibly damaging Het
Vmn1r16 A T 6: 57,300,091 (GRCm39) L177* probably null Het
Other mutations in Trim55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Trim55 APN 3 19,725,116 (GRCm39) missense probably damaging 1.00
IGL03095:Trim55 APN 3 19,728,629 (GRCm39) missense probably benign 0.00
IGL03411:Trim55 APN 3 19,713,354 (GRCm39) missense probably damaging 0.99
R0011:Trim55 UTSW 3 19,725,163 (GRCm39) missense probably benign 0.00
R0021:Trim55 UTSW 3 19,698,866 (GRCm39) missense probably benign 0.04
R0021:Trim55 UTSW 3 19,698,866 (GRCm39) missense probably benign 0.04
R0194:Trim55 UTSW 3 19,716,025 (GRCm39) missense probably benign 0.00
R0437:Trim55 UTSW 3 19,725,142 (GRCm39) missense probably benign
R0450:Trim55 UTSW 3 19,725,256 (GRCm39) missense possibly damaging 0.55
R0469:Trim55 UTSW 3 19,725,256 (GRCm39) missense possibly damaging 0.55
R1029:Trim55 UTSW 3 19,698,906 (GRCm39) missense probably damaging 1.00
R1397:Trim55 UTSW 3 19,698,801 (GRCm39) missense probably benign 0.01
R1928:Trim55 UTSW 3 19,716,046 (GRCm39) critical splice donor site probably null
R2079:Trim55 UTSW 3 19,698,830 (GRCm39) missense probably damaging 0.98
R3856:Trim55 UTSW 3 19,727,120 (GRCm39) missense probably benign
R4646:Trim55 UTSW 3 19,725,286 (GRCm39) missense probably benign 0.03
R4907:Trim55 UTSW 3 19,728,538 (GRCm39) missense probably benign
R5090:Trim55 UTSW 3 19,725,771 (GRCm39) missense probably benign 0.08
R5562:Trim55 UTSW 3 19,713,317 (GRCm39) missense probably benign 0.04
R6370:Trim55 UTSW 3 19,745,650 (GRCm39) missense possibly damaging 0.87
R6786:Trim55 UTSW 3 19,726,938 (GRCm39) missense probably benign
R8147:Trim55 UTSW 3 19,727,011 (GRCm39) missense probably benign 0.28
R8524:Trim55 UTSW 3 19,725,113 (GRCm39) missense probably benign 0.00
R8824:Trim55 UTSW 3 19,727,126 (GRCm39) missense probably benign
R8974:Trim55 UTSW 3 19,699,603 (GRCm39) missense probably damaging 0.96
R8977:Trim55 UTSW 3 19,713,341 (GRCm39) missense probably benign 0.17
R9283:Trim55 UTSW 3 19,699,612 (GRCm39) critical splice donor site probably null
R9302:Trim55 UTSW 3 19,727,153 (GRCm39) missense probably benign 0.04
R9380:Trim55 UTSW 3 19,728,559 (GRCm39) missense probably benign 0.00
R9657:Trim55 UTSW 3 19,728,671 (GRCm39) missense possibly damaging 0.46
R9732:Trim55 UTSW 3 19,716,039 (GRCm39) missense probably damaging 0.97
R9758:Trim55 UTSW 3 19,699,498 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGTGAATCACTTGAATGGC -3'
(R):5'- CATCTGGAATTAAAGGGTGGTG -3'

Sequencing Primer
(F):5'- GTGAATCACTTGAATGGCTCTTGACC -3'
(R):5'- CTGGAATTAAAGGGTGGTGGTGTTG -3'
Posted On 2018-07-23