Incidental Mutation 'R6658:Trim55'
ID526699
Institutional Source Beutler Lab
Gene Symbol Trim55
Ensembl Gene ENSMUSG00000060913
Gene Nametripartite motif-containing 55
SynonymsD830041C10Rik, Murf2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6658 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location19644474-19692421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19691555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 532 (R532C)
Ref Sequence ENSEMBL: ENSMUSP00000029139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139] [ENSMUST00000061294]
Predicted Effect probably damaging
Transcript: ENSMUST00000029139
AA Change: R532C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913
AA Change: R532C

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061294
SMART Domains Protein: ENSMUSP00000061185
Gene: ENSMUSG00000049796

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
CRF 146 185 1.55e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195674
Meta Mutation Damage Score 0.2531 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased heart and muscle to body weight ratios and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,195,300 N1340S probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Antxr1 C A 6: 87,284,309 R167L probably damaging Het
BC107364 T C 3: 96,440,710 S88G unknown Het
Cfap100 T G 6: 90,413,418 E80A probably damaging Het
Dhx8 C A 11: 101,764,922 H1107Q probably damaging Het
Dip2c G A 13: 9,493,177 probably null Het
Dpep2 A T 8: 105,989,910 D212E probably benign Het
Dpep3 T C 8: 105,979,096 T66A probably benign Het
Fat4 G T 3: 38,942,928 M1765I probably benign Het
Gbgt1 G A 2: 28,504,986 R212H probably benign Het
Gimap4 T C 6: 48,691,404 S215P possibly damaging Het
Gpr161 A T 1: 165,306,567 T133S possibly damaging Het
Grin2c G T 11: 115,258,282 S163R possibly damaging Het
Grip2 T A 6: 91,786,491 N109Y probably damaging Het
H60c G A 10: 3,260,270 T93I possibly damaging Het
Hmgcl A G 4: 135,955,651 N138S probably damaging Het
Hoxa3 G T 6: 52,170,078 Y398* probably null Het
Igkv1-132 A G 6: 67,760,107 N19S probably benign Het
Ikbip A G 10: 91,096,319 N275S probably benign Het
Il7 T A 3: 7,577,179 T33S probably benign Het
Iqgap2 A T 13: 95,660,332 Y1105N probably damaging Het
Lmo7 A G 14: 101,910,845 D934G possibly damaging Het
Mroh4 T C 15: 74,621,129 Q310R possibly damaging Het
Mtmr14 C A 6: 113,265,476 Y22* probably null Het
Muc5b G T 7: 141,868,507 probably null Het
Naga T G 15: 82,330,774 K328Q probably benign Het
Neo1 G A 9: 58,921,849 T589I probably benign Het
Nme5 A C 18: 34,578,586 I34S probably damaging Het
Nrip2 T C 6: 128,408,236 L210P possibly damaging Het
Nup93 A G 8: 94,304,179 D424G probably benign Het
Olfr1121 T C 2: 87,372,153 V207A probably benign Het
Olfr385 G A 11: 73,589,048 S230F probably damaging Het
Papss1 T A 3: 131,605,935 V308E probably benign Het
Pilrb1 T A 5: 137,857,527 Y34F probably benign Het
Pira2 T A 7: 3,842,301 E319D probably benign Het
Pkhd1 G A 1: 20,612,705 T91M probably damaging Het
Prph2 A G 17: 46,919,864 T228A probably benign Het
Ranbp17 G T 11: 33,219,214 S1000* probably null Het
Rbm27 A C 18: 42,324,113 H651P probably damaging Het
Scyl2 A T 10: 89,640,973 D763E probably benign Het
Sltm A G 9: 70,581,362 Y598C probably damaging Het
Smc2 A T 4: 52,451,322 K322I probably benign Het
Tcf4 G A 18: 69,657,802 R271Q probably null Het
Tex36 C T 7: 133,594,411 D87N probably damaging Het
Tex44 A C 1: 86,427,029 H220P probably benign Het
Tjp1 T C 7: 65,301,077 D1683G possibly damaging Het
Trav7-2 T C 14: 53,391,116 S104P probably damaging Het
Ube3c T A 5: 29,602,217 L338Q probably damaging Het
Ush2a A G 1: 188,814,359 H3444R possibly damaging Het
Vars A G 17: 35,015,741 D1182G probably benign Het
Vit T A 17: 78,622,803 I399N possibly damaging Het
Vmn1r16 A T 6: 57,323,106 L177* probably null Het
Other mutations in Trim55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Trim55 APN 3 19670952 missense probably damaging 1.00
IGL03095:Trim55 APN 3 19674465 missense probably benign 0.00
IGL03411:Trim55 APN 3 19659190 missense probably damaging 0.99
R0011:Trim55 UTSW 3 19670999 missense probably benign 0.00
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0194:Trim55 UTSW 3 19661861 missense probably benign 0.00
R0437:Trim55 UTSW 3 19670978 missense probably benign
R0450:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R0469:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R1029:Trim55 UTSW 3 19644742 missense probably damaging 1.00
R1397:Trim55 UTSW 3 19644637 missense probably benign 0.01
R1928:Trim55 UTSW 3 19661882 critical splice donor site probably null
R2079:Trim55 UTSW 3 19644666 missense probably damaging 0.98
R3856:Trim55 UTSW 3 19672956 missense probably benign
R4646:Trim55 UTSW 3 19671122 missense probably benign 0.03
R4907:Trim55 UTSW 3 19674374 missense probably benign
R5090:Trim55 UTSW 3 19671607 missense probably benign 0.08
R5562:Trim55 UTSW 3 19659153 missense probably benign 0.04
R6370:Trim55 UTSW 3 19691486 missense possibly damaging 0.87
R6786:Trim55 UTSW 3 19672774 missense probably benign
R8147:Trim55 UTSW 3 19672847 missense probably benign 0.28
R8524:Trim55 UTSW 3 19670949 missense probably benign 0.00
R8824:Trim55 UTSW 3 19672962 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGTGAATCACTTGAATGGC -3'
(R):5'- CATCTGGAATTAAAGGGTGGTG -3'

Sequencing Primer
(F):5'- GTGAATCACTTGAATGGCTCTTGACC -3'
(R):5'- CTGGAATTAAAGGGTGGTGGTGTTG -3'
Posted On2018-07-23