Incidental Mutation 'R6658:Akr1b3'
ID526708
Institutional Source Beutler Lab
Gene Symbol Akr1b3
Ensembl Gene ENSMUSG00000001642
Gene Namealdo-keto reductase family 1, member B3 (aldose reductase)
SynonymsAhr-1, Aldor1, Ahr1, ALR2, Aldr1, AR
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6658 (G1)
Quality Score160.009
Status Validated
Chromosome6
Chromosomal Location34302434-34317478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34310004 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 206 (V206M)
Ref Sequence ENSEMBL: ENSMUSP00000100045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102980
AA Change: V206M

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: V206M

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142761
Predicted Effect probably benign
Transcript: ENSMUST00000154655
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201392
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,195,300 N1340S probably damaging Het
Antxr1 C A 6: 87,284,309 R167L probably damaging Het
BC107364 T C 3: 96,440,710 S88G unknown Het
Cfap100 T G 6: 90,413,418 E80A probably damaging Het
Dhx8 C A 11: 101,764,922 H1107Q probably damaging Het
Dip2c G A 13: 9,493,177 probably null Het
Dpep2 A T 8: 105,989,910 D212E probably benign Het
Dpep3 T C 8: 105,979,096 T66A probably benign Het
Fat4 G T 3: 38,942,928 M1765I probably benign Het
Gbgt1 G A 2: 28,504,986 R212H probably benign Het
Gimap4 T C 6: 48,691,404 S215P possibly damaging Het
Gpr161 A T 1: 165,306,567 T133S possibly damaging Het
Grin2c G T 11: 115,258,282 S163R possibly damaging Het
Grip2 T A 6: 91,786,491 N109Y probably damaging Het
H60c G A 10: 3,260,270 T93I possibly damaging Het
Hmgcl A G 4: 135,955,651 N138S probably damaging Het
Hoxa3 G T 6: 52,170,078 Y398* probably null Het
Igkv1-132 A G 6: 67,760,107 N19S probably benign Het
Ikbip A G 10: 91,096,319 N275S probably benign Het
Il7 T A 3: 7,577,179 T33S probably benign Het
Iqgap2 A T 13: 95,660,332 Y1105N probably damaging Het
Lmo7 A G 14: 101,910,845 D934G possibly damaging Het
Mroh4 T C 15: 74,621,129 Q310R possibly damaging Het
Mtmr14 C A 6: 113,265,476 Y22* probably null Het
Muc5b G T 7: 141,868,507 probably null Het
Naga T G 15: 82,330,774 K328Q probably benign Het
Neo1 G A 9: 58,921,849 T589I probably benign Het
Nme5 A C 18: 34,578,586 I34S probably damaging Het
Nrip2 T C 6: 128,408,236 L210P possibly damaging Het
Nup93 A G 8: 94,304,179 D424G probably benign Het
Olfr1121 T C 2: 87,372,153 V207A probably benign Het
Olfr385 G A 11: 73,589,048 S230F probably damaging Het
Papss1 T A 3: 131,605,935 V308E probably benign Het
Pilrb1 T A 5: 137,857,527 Y34F probably benign Het
Pira2 T A 7: 3,842,301 E319D probably benign Het
Pkhd1 G A 1: 20,612,705 T91M probably damaging Het
Prph2 A G 17: 46,919,864 T228A probably benign Het
Ranbp17 G T 11: 33,219,214 S1000* probably null Het
Rbm27 A C 18: 42,324,113 H651P probably damaging Het
Scyl2 A T 10: 89,640,973 D763E probably benign Het
Sltm A G 9: 70,581,362 Y598C probably damaging Het
Smc2 A T 4: 52,451,322 K322I probably benign Het
Tcf4 G A 18: 69,657,802 R271Q probably null Het
Tex36 C T 7: 133,594,411 D87N probably damaging Het
Tex44 A C 1: 86,427,029 H220P probably benign Het
Tjp1 T C 7: 65,301,077 D1683G possibly damaging Het
Trav7-2 T C 14: 53,391,116 S104P probably damaging Het
Trim55 C T 3: 19,691,555 R532C probably damaging Het
Ube3c T A 5: 29,602,217 L338Q probably damaging Het
Ush2a A G 1: 188,814,359 H3444R possibly damaging Het
Vars A G 17: 35,015,741 D1182G probably benign Het
Vit T A 17: 78,622,803 I399N possibly damaging Het
Vmn1r16 A T 6: 57,323,106 L177* probably null Het
Other mutations in Akr1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b3 APN 6 34304319 missense probably damaging 1.00
R0567:Akr1b3 UTSW 6 34304345 splice site probably null
R0611:Akr1b3 UTSW 6 34309642 missense probably benign 0.02
R1564:Akr1b3 UTSW 6 34306535 splice site probably null
R2445:Akr1b3 UTSW 6 34310934 missense probably benign 0.26
R2507:Akr1b3 UTSW 6 34310064 missense probably damaging 1.00
R4323:Akr1b3 UTSW 6 34310927 missense probably benign 0.00
R4373:Akr1b3 UTSW 6 34304267 utr 3 prime probably benign
R4606:Akr1b3 UTSW 6 34306664 unclassified probably benign
R5513:Akr1b3 UTSW 6 34316646 intron probably benign
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6560:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6561:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6632:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6654:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6655:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6657:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6662:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R8209:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
R8226:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGAAGAATATCCATCTTGTTCC -3'
(R):5'- GGCCATCAACTGGGAAATGTG -3'

Sequencing Primer
(F):5'- TTCCTAGGAACATCAACCTCCCAG -3'
(R):5'- GGGGGAGTTGTTACAGCTTATC -3'
Posted On2018-07-23