Mutagenetix > Incidental Mutation

Incidental Mutation 'R6658:Nup93'

526722

Institutional Source

Beutler Lab

Gene Symbol

Nup93

Ensembl Gene

ENSMUSG00000032939

Gene Name

nucleoporin 93

Synonyms

2410008G02Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R6658 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94214564-94317227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94304179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 424 (D424G)

Ref Sequence

ENSEMBL: ENSMUSP00000148700 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]

AlphaFold

Q8BJ71

Predicted Effect

probably benign
Transcript: ENSMUST00000079961
AA Change: D424G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: D424G

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	214	804	6.9e-198	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109547
AA Change: D424G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: D424G

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	202	804	8.2e-202	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211822
AA Change: D301G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000212824
AA Change: D424G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212984

Meta Mutation Damage Score

0.1564

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts7	A	G	9: 90,195,300	N1340S	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Antxr1	C	A	6: 87,284,309	R167L	probably damaging	Het
BC107364	T	C	3: 96,440,710	S88G	unknown	Het
Cfap100	T	G	6: 90,413,418	E80A	probably damaging	Het
Dhx8	C	A	11: 101,764,922	H1107Q	probably damaging	Het
Dip2c	G	A	13: 9,493,177		probably null	Het
Dpep2	A	T	8: 105,989,910	D212E	probably benign	Het
Dpep3	T	C	8: 105,979,096	T66A	probably benign	Het
Fat4	G	T	3: 38,942,928	M1765I	probably benign	Het
Gbgt1	G	A	2: 28,504,986	R212H	probably benign	Het
Gimap4	T	C	6: 48,691,404	S215P	possibly damaging	Het
Gpr161	A	T	1: 165,306,567	T133S	possibly damaging	Het
Grin2c	G	T	11: 115,258,282	S163R	possibly damaging	Het
Grip2	T	A	6: 91,786,491	N109Y	probably damaging	Het
H60c	G	A	10: 3,260,270	T93I	possibly damaging	Het
Hmgcl	A	G	4: 135,955,651	N138S	probably damaging	Het
Hoxa3	G	T	6: 52,170,078	Y398*	probably null	Het
Igkv1-132	A	G	6: 67,760,107	N19S	probably benign	Het
Ikbip	A	G	10: 91,096,319	N275S	probably benign	Het
Il7	T	A	3: 7,577,179	T33S	probably benign	Het
Iqgap2	A	T	13: 95,660,332	Y1105N	probably damaging	Het
Lmo7	A	G	14: 101,910,845	D934G	possibly damaging	Het
Mroh4	T	C	15: 74,621,129	Q310R	possibly damaging	Het
Mtmr14	C	A	6: 113,265,476	Y22*	probably null	Het
Muc5b	G	T	7: 141,868,507		probably null	Het
Naga	T	G	15: 82,330,774	K328Q	probably benign	Het
Neo1	G	A	9: 58,921,849	T589I	probably benign	Het
Nme5	A	C	18: 34,578,586	I34S	probably damaging	Het
Nrip2	T	C	6: 128,408,236	L210P	possibly damaging	Het
Olfr1121	T	C	2: 87,372,153	V207A	probably benign	Het
Olfr385	G	A	11: 73,589,048	S230F	probably damaging	Het
Papss1	T	A	3: 131,605,935	V308E	probably benign	Het
Pilrb1	T	A	5: 137,857,527	Y34F	probably benign	Het
Pira2	T	A	7: 3,842,301	E319D	probably benign	Het
Pkhd1	G	A	1: 20,612,705	T91M	probably damaging	Het
Prph2	A	G	17: 46,919,864	T228A	probably benign	Het
Ranbp17	G	T	11: 33,219,214	S1000*	probably null	Het
Rbm27	A	C	18: 42,324,113	H651P	probably damaging	Het
Scyl2	A	T	10: 89,640,973	D763E	probably benign	Het
Sltm	A	G	9: 70,581,362	Y598C	probably damaging	Het
Smc2	A	T	4: 52,451,322	K322I	probably benign	Het
Tcf4	G	A	18: 69,657,802	R271Q	probably null	Het
Tex36	C	T	7: 133,594,411	D87N	probably damaging	Het
Tex44	A	C	1: 86,427,029	H220P	probably benign	Het
Tjp1	T	C	7: 65,301,077	D1683G	possibly damaging	Het
Trav7-2	T	C	14: 53,391,116	S104P	probably damaging	Het
Trim55	C	T	3: 19,691,555	R532C	probably damaging	Het
Ube3c	T	A	5: 29,602,217	L338Q	probably damaging	Het
Ush2a	A	G	1: 188,814,359	H3444R	possibly damaging	Het
Vars	A	G	17: 35,015,741	D1182G	probably benign	Het
Vit	T	A	17: 78,622,803	I399N	possibly damaging	Het
Vmn1r16	A	T	6: 57,323,106	L177*	probably null	Het

Other mutations in Nup93

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Nup93	APN	8	94309023	critical splice donor site	probably null
IGL01652:Nup93	APN	8	94296559	missense	possibly damaging	0.93
IGL02003:Nup93	APN	8	94302109	nonsense	probably null
IGL02169:Nup93	APN	8	94302129	missense	probably damaging	1.00
IGL02212:Nup93	APN	8	94311662	critical splice donor site	probably null
IGL02551:Nup93	APN	8	94227833	nonsense	probably null
IGL02568:Nup93	APN	8	94309635	missense	probably damaging	1.00
IGL03094:Nup93	APN	8	94296502	missense	probably benign
IGL03248:Nup93	APN	8	94306088	missense	probably damaging	0.98
IGL03273:Nup93	APN	8	94306277	missense	probably benign	0.01
IGL03401:Nup93	APN	8	94309711	splice site	probably null
PIT4585001:Nup93	UTSW	8	94243727	missense	probably benign	0.25
R0409:Nup93	UTSW	8	94303665	missense	probably damaging	1.00
R0748:Nup93	UTSW	8	94307943	missense	probably damaging	1.00
R0891:Nup93	UTSW	8	94281263	splice site	probably benign
R1667:Nup93	UTSW	8	94292687	missense	possibly damaging	0.71
R1696:Nup93	UTSW	8	94296555	missense	probably benign	0.29
R1862:Nup93	UTSW	8	94306102	missense	probably damaging	1.00
R2069:Nup93	UTSW	8	94243739	missense	probably damaging	1.00
R2143:Nup93	UTSW	8	94296480	nonsense	probably null
R2187:Nup93	UTSW	8	94300850	missense	probably damaging	1.00
R2228:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2229:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2254:Nup93	UTSW	8	94227857	critical splice donor site	probably null
R2884:Nup93	UTSW	8	94303638	missense	probably damaging	1.00
R4521:Nup93	UTSW	8	94314636	missense	probably damaging	1.00
R4563:Nup93	UTSW	8	94307892	missense	probably damaging	1.00
R4900:Nup93	UTSW	8	94286603	missense	probably benign	0.25
R5570:Nup93	UTSW	8	94314670	missense	probably damaging	1.00
R6226:Nup93	UTSW	8	94286537	missense	probably damaging	1.00
R6489:Nup93	UTSW	8	94302088	missense	probably benign	0.10
R6817:Nup93	UTSW	8	94314682	critical splice donor site	probably null
R6895:Nup93	UTSW	8	94243686	missense	probably damaging	1.00
R6955:Nup93	UTSW	8	94309673	missense	probably damaging	0.96
R7476:Nup93	UTSW	8	94303632	missense	probably damaging	1.00
R7643:Nup93	UTSW	8	94286619	critical splice donor site	probably null
R7994:Nup93	UTSW	8	94306302	missense	probably benign	0.15
R8461:Nup93	UTSW	8	94281335	critical splice donor site	probably null
R9177:Nup93	UTSW	8	94227743	missense	probably benign	0.25
R9264:Nup93	UTSW	8	94292720	missense	probably benign	0.01
R9532:Nup93	UTSW	8	94314621	missense	probably damaging	1.00
R9567:Nup93	UTSW	8	94308976	missense	possibly damaging	0.94
R9629:Nup93	UTSW	8	94306639	missense	probably damaging	0.99
R9721:Nup93	UTSW	8	94303685	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAGGGACAGTGGATTTTGTATC -3'
(R):5'- CCAAGTGATGCATATTTCTTAACGC -3'

Sequencing Primer
(F):5'- CGGAATTTAGGGCATCAGTCATG -3'
(R):5'- ACGCATAATGGTCTGTACCTG -3'

Posted On

2018-07-23