Incidental Mutation 'R6658:Ranbp17'
ID526731
Institutional Source Beutler Lab
Gene Symbol Ranbp17
Ensembl Gene ENSMUSG00000040594
Gene NameRAN binding protein 17
Synonyms4932704E15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6658 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location33211795-33513746 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 33219214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 1000 (S1000*)
Ref Sequence ENSEMBL: ENSMUSP00000099879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102815]
Predicted Effect probably null
Transcript: ENSMUST00000102815
AA Change: S1000*
SMART Domains Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594
AA Change: S1000*

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131851
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,195,300 N1340S probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Antxr1 C A 6: 87,284,309 R167L probably damaging Het
BC107364 T C 3: 96,440,710 S88G unknown Het
Cfap100 T G 6: 90,413,418 E80A probably damaging Het
Dhx8 C A 11: 101,764,922 H1107Q probably damaging Het
Dip2c G A 13: 9,493,177 probably null Het
Dpep2 A T 8: 105,989,910 D212E probably benign Het
Dpep3 T C 8: 105,979,096 T66A probably benign Het
Fat4 G T 3: 38,942,928 M1765I probably benign Het
Gbgt1 G A 2: 28,504,986 R212H probably benign Het
Gimap4 T C 6: 48,691,404 S215P possibly damaging Het
Gpr161 A T 1: 165,306,567 T133S possibly damaging Het
Grin2c G T 11: 115,258,282 S163R possibly damaging Het
Grip2 T A 6: 91,786,491 N109Y probably damaging Het
H60c G A 10: 3,260,270 T93I possibly damaging Het
Hmgcl A G 4: 135,955,651 N138S probably damaging Het
Hoxa3 G T 6: 52,170,078 Y398* probably null Het
Igkv1-132 A G 6: 67,760,107 N19S probably benign Het
Ikbip A G 10: 91,096,319 N275S probably benign Het
Il7 T A 3: 7,577,179 T33S probably benign Het
Iqgap2 A T 13: 95,660,332 Y1105N probably damaging Het
Lmo7 A G 14: 101,910,845 D934G possibly damaging Het
Mroh4 T C 15: 74,621,129 Q310R possibly damaging Het
Mtmr14 C A 6: 113,265,476 Y22* probably null Het
Muc5b G T 7: 141,868,507 probably null Het
Naga T G 15: 82,330,774 K328Q probably benign Het
Neo1 G A 9: 58,921,849 T589I probably benign Het
Nme5 A C 18: 34,578,586 I34S probably damaging Het
Nrip2 T C 6: 128,408,236 L210P possibly damaging Het
Nup93 A G 8: 94,304,179 D424G probably benign Het
Olfr1121 T C 2: 87,372,153 V207A probably benign Het
Olfr385 G A 11: 73,589,048 S230F probably damaging Het
Papss1 T A 3: 131,605,935 V308E probably benign Het
Pilrb1 T A 5: 137,857,527 Y34F probably benign Het
Pira2 T A 7: 3,842,301 E319D probably benign Het
Pkhd1 G A 1: 20,612,705 T91M probably damaging Het
Prph2 A G 17: 46,919,864 T228A probably benign Het
Rbm27 A C 18: 42,324,113 H651P probably damaging Het
Scyl2 A T 10: 89,640,973 D763E probably benign Het
Sltm A G 9: 70,581,362 Y598C probably damaging Het
Smc2 A T 4: 52,451,322 K322I probably benign Het
Tcf4 G A 18: 69,657,802 R271Q probably null Het
Tex36 C T 7: 133,594,411 D87N probably damaging Het
Tex44 A C 1: 86,427,029 H220P probably benign Het
Tjp1 T C 7: 65,301,077 D1683G possibly damaging Het
Trav7-2 T C 14: 53,391,116 S104P probably damaging Het
Trim55 C T 3: 19,691,555 R532C probably damaging Het
Ube3c T A 5: 29,602,217 L338Q probably damaging Het
Ush2a A G 1: 188,814,359 H3444R possibly damaging Het
Vars A G 17: 35,015,741 D1182G probably benign Het
Vit T A 17: 78,622,803 I399N possibly damaging Het
Vmn1r16 A T 6: 57,323,106 L177* probably null Het
Other mutations in Ranbp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ranbp17 APN 11 33493402 missense probably benign 0.13
IGL00582:Ranbp17 APN 11 33504683 missense probably damaging 0.99
IGL00698:Ranbp17 APN 11 33441910 missense probably benign 0.00
IGL00789:Ranbp17 APN 11 33243249 missense probably benign 0.27
IGL01304:Ranbp17 APN 11 33266147 missense possibly damaging 0.91
IGL01936:Ranbp17 APN 11 33487689 missense probably benign 0.00
IGL01937:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01945:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01993:Ranbp17 APN 11 33500770 missense possibly damaging 0.48
IGL02588:Ranbp17 APN 11 33217361 missense probably benign
IGL02870:Ranbp17 APN 11 33243262 missense probably damaging 1.00
IGL03149:Ranbp17 APN 11 33243183 missense possibly damaging 0.76
PIT4445001:Ranbp17 UTSW 11 33481020 critical splice donor site probably null
PIT4480001:Ranbp17 UTSW 11 33297340 critical splice donor site probably null
R0079:Ranbp17 UTSW 11 33500682 missense probably damaging 1.00
R0349:Ranbp17 UTSW 11 33500689 missense probably benign
R0395:Ranbp17 UTSW 11 33474896 missense probably benign
R1456:Ranbp17 UTSW 11 33266310 missense probably damaging 1.00
R1539:Ranbp17 UTSW 11 33297394 missense probably damaging 0.99
R1542:Ranbp17 UTSW 11 33264672 missense probably benign
R1770:Ranbp17 UTSW 11 33217301 missense probably benign 0.31
R2216:Ranbp17 UTSW 11 33481125 missense probably damaging 1.00
R2656:Ranbp17 UTSW 11 33243122 missense probably benign
R2883:Ranbp17 UTSW 11 33504708 missense probably damaging 1.00
R3498:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3499:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3721:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3788:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3790:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3914:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3915:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3949:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4021:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4022:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4027:Ranbp17 UTSW 11 33500718 missense possibly damaging 0.67
R4421:Ranbp17 UTSW 11 33475056 missense probably benign 0.01
R4462:Ranbp17 UTSW 11 33217421 critical splice acceptor site probably null
R4659:Ranbp17 UTSW 11 33266288 missense probably damaging 1.00
R4791:Ranbp17 UTSW 11 33487746 missense probably benign 0.11
R4837:Ranbp17 UTSW 11 33328451 missense probably damaging 1.00
R4914:Ranbp17 UTSW 11 33213425 missense probably benign
R4939:Ranbp17 UTSW 11 33219223 missense probably benign 0.31
R5119:Ranbp17 UTSW 11 33404181 makesense probably null
R5171:Ranbp17 UTSW 11 33217419 missense probably benign
R5182:Ranbp17 UTSW 11 33219287 intron probably benign
R5288:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5384:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5385:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5398:Ranbp17 UTSW 11 33474998 missense probably damaging 1.00
R6701:Ranbp17 UTSW 11 33475066 missense probably damaging 1.00
R6796:Ranbp17 UTSW 11 33217398 missense probably benign
R6869:Ranbp17 UTSW 11 33513074 start gained probably benign
R7096:Ranbp17 UTSW 11 33474896 missense probably benign
R7156:Ranbp17 UTSW 11 33297420 missense probably damaging 1.00
X0013:Ranbp17 UTSW 11 33289562 unclassified probably null
X0024:Ranbp17 UTSW 11 33213404 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTAGAATGGCAAGGCAG -3'
(R):5'- CAGAGTGAGAGCCAAGTGTC -3'

Sequencing Primer
(F):5'- TCTGGGATACTGCCGAGCAAG -3'
(R):5'- CCAAGTGTCCAGGGAAAGCC -3'
Posted On2018-07-23