Incidental Mutation 'R6658:Prph2'
ID526741
Institutional Source Beutler Lab
Gene Symbol Prph2
Ensembl Gene ENSMUSG00000023978
Gene Nameperipherin 2
SynonymsNmf193, Rd2, rds, Tspan22
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6658 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46910459-46924933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46919864 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 228 (T228A)
Ref Sequence ENSEMBL: ENSMUSP00000024773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024773]
Predicted Effect probably benign
Transcript: ENSMUST00000024773
AA Change: T228A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: T228A

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 288 2.2e-28 PFAM
low complexity region 333 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162469
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 A G 9: 90,195,300 N1340S probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Antxr1 C A 6: 87,284,309 R167L probably damaging Het
BC107364 T C 3: 96,440,710 S88G unknown Het
Cfap100 T G 6: 90,413,418 E80A probably damaging Het
Dhx8 C A 11: 101,764,922 H1107Q probably damaging Het
Dip2c G A 13: 9,493,177 probably null Het
Dpep2 A T 8: 105,989,910 D212E probably benign Het
Dpep3 T C 8: 105,979,096 T66A probably benign Het
Fat4 G T 3: 38,942,928 M1765I probably benign Het
Gbgt1 G A 2: 28,504,986 R212H probably benign Het
Gimap4 T C 6: 48,691,404 S215P possibly damaging Het
Gpr161 A T 1: 165,306,567 T133S possibly damaging Het
Grin2c G T 11: 115,258,282 S163R possibly damaging Het
Grip2 T A 6: 91,786,491 N109Y probably damaging Het
H60c G A 10: 3,260,270 T93I possibly damaging Het
Hmgcl A G 4: 135,955,651 N138S probably damaging Het
Hoxa3 G T 6: 52,170,078 Y398* probably null Het
Igkv1-132 A G 6: 67,760,107 N19S probably benign Het
Ikbip A G 10: 91,096,319 N275S probably benign Het
Il7 T A 3: 7,577,179 T33S probably benign Het
Iqgap2 A T 13: 95,660,332 Y1105N probably damaging Het
Lmo7 A G 14: 101,910,845 D934G possibly damaging Het
Mroh4 T C 15: 74,621,129 Q310R possibly damaging Het
Mtmr14 C A 6: 113,265,476 Y22* probably null Het
Muc5b G T 7: 141,868,507 probably null Het
Naga T G 15: 82,330,774 K328Q probably benign Het
Neo1 G A 9: 58,921,849 T589I probably benign Het
Nme5 A C 18: 34,578,586 I34S probably damaging Het
Nrip2 T C 6: 128,408,236 L210P possibly damaging Het
Nup93 A G 8: 94,304,179 D424G probably benign Het
Olfr1121 T C 2: 87,372,153 V207A probably benign Het
Olfr385 G A 11: 73,589,048 S230F probably damaging Het
Papss1 T A 3: 131,605,935 V308E probably benign Het
Pilrb1 T A 5: 137,857,527 Y34F probably benign Het
Pira2 T A 7: 3,842,301 E319D probably benign Het
Pkhd1 G A 1: 20,612,705 T91M probably damaging Het
Ranbp17 G T 11: 33,219,214 S1000* probably null Het
Rbm27 A C 18: 42,324,113 H651P probably damaging Het
Scyl2 A T 10: 89,640,973 D763E probably benign Het
Sltm A G 9: 70,581,362 Y598C probably damaging Het
Smc2 A T 4: 52,451,322 K322I probably benign Het
Tcf4 G A 18: 69,657,802 R271Q probably null Het
Tex36 C T 7: 133,594,411 D87N probably damaging Het
Tex44 A C 1: 86,427,029 H220P probably benign Het
Tjp1 T C 7: 65,301,077 D1683G possibly damaging Het
Trav7-2 T C 14: 53,391,116 S104P probably damaging Het
Trim55 C T 3: 19,691,555 R532C probably damaging Het
Ube3c T A 5: 29,602,217 L338Q probably damaging Het
Ush2a A G 1: 188,814,359 H3444R possibly damaging Het
Vars A G 17: 35,015,741 D1182G probably benign Het
Vit T A 17: 78,622,803 I399N possibly damaging Het
Vmn1r16 A T 6: 57,323,106 L177* probably null Het
Other mutations in Prph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Prph2 APN 17 46919778 missense probably damaging 0.97
IGL01087:Prph2 APN 17 46911159 missense probably damaging 0.97
PIT4480001:Prph2 UTSW 17 46911113 frame shift probably null
R0025:Prph2 UTSW 17 46919771 missense probably benign 0.17
R2235:Prph2 UTSW 17 46911166 missense probably damaging 1.00
R3120:Prph2 UTSW 17 46923372 missense possibly damaging 0.49
R3954:Prph2 UTSW 17 46910718 missense probably benign 0.39
R4864:Prph2 UTSW 17 46910922 missense probably benign 0.03
R4972:Prph2 UTSW 17 46910807 missense possibly damaging 0.94
R5645:Prph2 UTSW 17 46910667 start gained probably benign
R5687:Prph2 UTSW 17 46923465 missense probably damaging 0.99
R6494:Prph2 UTSW 17 46911081 missense probably benign 0.03
R7775:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R7778:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R7824:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAAAATCTAGGTTCTCGGGGCATG -3'
(R):5'- ACCAGGTCTGTCTTCACCATG -3'

Sequencing Primer
(F):5'- CATGGGAGGATCTGCTGC -3'
(R):5'- TGTTAAACCCAAGTCTGGCAG -3'
Posted On2018-07-23