Incidental Mutation 'R6659:Iars2'
ID526748
Institutional Source Beutler Lab
Gene Symbol Iars2
Ensembl Gene ENSMUSG00000026618
Gene Nameisoleucine-tRNA synthetase 2, mitochondrial
Synonyms2010002H18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6659 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location185284726-185329396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 185288076 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 954 (I954F)
Ref Sequence ENSEMBL: ENSMUSP00000027921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000069652] [ENSMUST00000194740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027921
AA Change: I954F

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: I954F

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 3.6e-172 PFAM
Pfam:tRNA-synt_1g 112 268 7e-15 PFAM
Pfam:tRNA-synt_1_2 334 462 3.8e-7 PFAM
Pfam:Anticodon_1 756 920 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069652
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193482
Predicted Effect probably benign
Transcript: ENSMUST00000194740
SMART Domains Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-157 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 766 1346 2.5e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195042
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,131,315 D212G probably damaging Het
Add1 C T 5: 34,613,295 A250V possibly damaging Het
Atxn2 A G 5: 121,777,964 N411S probably benign Het
AW551984 T C 9: 39,589,099 T788A probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddx46 A G 13: 55,669,724 T721A probably damaging Het
Eif2b1 G A 5: 124,579,108 probably benign Het
Eif4g3 A G 4: 138,177,932 K1241E probably damaging Het
Engase T A 11: 118,481,316 Y145N probably benign Het
Fbrs C A 7: 127,487,919 A674D probably damaging Het
Gm4884 G A 7: 41,044,622 G672R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itgad A T 7: 128,185,948 I310F probably damaging Het
Kcnmb3 A G 3: 32,472,445 V199A possibly damaging Het
Kctd12 G T 14: 102,982,186 D85E probably damaging Het
Lama1 G A 17: 67,818,635 R2929H probably damaging Het
Lgmn T A 12: 102,402,692 Y176F probably benign Het
Lipo3 A G 19: 33,556,428 F335L possibly damaging Het
Map2k3 T C 11: 60,942,324 S46P probably benign Het
Megf8 C A 7: 25,358,734 H2144Q probably benign Het
Neb A T 2: 52,234,353 W3694R probably damaging Het
Nek10 A G 14: 14,861,684 E580G probably benign Het
Obscn G A 11: 59,039,009 P5930S probably damaging Het
Palld A G 8: 61,533,443 F621L probably benign Het
Pkn2 A T 3: 142,803,587 I732N probably damaging Het
Plpbp T A 8: 27,052,279 I214N possibly damaging Het
Ppp1r37 A G 7: 19,532,123 S573P probably benign Het
Prg4 C A 1: 150,460,681 C97F probably damaging Het
Prmt2 T C 10: 76,217,374 D269G possibly damaging Het
Ptbp3 T A 4: 59,517,640 L80F probably damaging Het
Reep1 T A 6: 71,773,195 F64I probably damaging Het
Srcap C A 7: 127,542,391 P1720Q probably damaging Het
Ssr1 A T 13: 37,987,690 F124I probably damaging Het
Tbx18 A G 9: 87,707,811 L358P probably damaging Het
Tfpt T C 7: 3,620,836 K71E probably benign Het
Tmem132a C A 19: 10,860,321 G542C probably damaging Het
Tmem135 C A 7: 89,307,163 L81F probably benign Het
Tmem135 A T 7: 89,307,164 L81* probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Washc5 A G 15: 59,340,890 probably null Het
Zfp24 T C 18: 24,017,334 E173G possibly damaging Het
Zgrf1 T C 3: 127,616,506 I1814T probably damaging Het
Other mutations in Iars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Iars2 APN 1 185315954 missense probably benign 0.00
IGL00906:Iars2 APN 1 185296403 splice site probably benign
IGL01287:Iars2 APN 1 185296428 missense possibly damaging 0.90
IGL01814:Iars2 APN 1 185302775 nonsense probably null
IGL02016:Iars2 APN 1 185303306 missense probably damaging 0.99
IGL02995:Iars2 APN 1 185303301 missense probably benign
IGL03002:Iars2 APN 1 185322816 splice site probably null
IGL03248:Iars2 APN 1 185291432 unclassified probably benign
R0304:Iars2 UTSW 1 185287156 missense possibly damaging 0.77
R0711:Iars2 UTSW 1 185322388 splice site probably benign
R0783:Iars2 UTSW 1 185320874 missense probably damaging 1.00
R0990:Iars2 UTSW 1 185318627 missense probably damaging 1.00
R1867:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1868:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1957:Iars2 UTSW 1 185295671 missense possibly damaging 0.89
R2378:Iars2 UTSW 1 185327721 missense probably damaging 1.00
R3784:Iars2 UTSW 1 185287131 missense probably benign 0.17
R4061:Iars2 UTSW 1 185303386 missense possibly damaging 0.85
R4334:Iars2 UTSW 1 185303394 missense probably benign 0.35
R4708:Iars2 UTSW 1 185289357 missense probably benign 0.00
R4723:Iars2 UTSW 1 185315979 missense probably damaging 1.00
R4729:Iars2 UTSW 1 185316051 missense possibly damaging 0.71
R4851:Iars2 UTSW 1 185327648 missense probably damaging 0.99
R5033:Iars2 UTSW 1 185317928 missense possibly damaging 0.65
R5215:Iars2 UTSW 1 185294769 missense probably damaging 1.00
R5260:Iars2 UTSW 1 185323734 missense probably damaging 1.00
R5286:Iars2 UTSW 1 185323121 intron probably benign
R5614:Iars2 UTSW 1 185289508 missense probably benign 0.00
R6838:Iars2 UTSW 1 185329145 missense probably damaging 0.98
R7057:Iars2 UTSW 1 185289367 missense probably benign 0.03
R7462:Iars2 UTSW 1 185322866 missense probably damaging 1.00
R7690:Iars2 UTSW 1 185320997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACTGTATCAGAACACG -3'
(R):5'- CTCCAGTCAACAGCTAAAAGTG -3'

Sequencing Primer
(F):5'- GTGACAGTCACTCATGGGTG -3'
(R):5'- GTCAACAGCTAAAAGTGACTGTC -3'
Posted On2018-07-23