Incidental Mutation 'R6659:Reep1'
ID526758
Institutional Source Beutler Lab
Gene Symbol Reep1
Ensembl Gene ENSMUSG00000052852
Gene Namereceptor accessory protein 1
SynonymsD6Ertd253e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6659 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71707561-71810710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71773195 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 64 (F64I)
Ref Sequence ENSEMBL: ENSMUSP00000112662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121469] [ENSMUST00000212631] [ENSMUST00000212792]
Predicted Effect probably damaging
Transcript: ENSMUST00000121469
AA Change: F64I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112662
Gene: ENSMUSG00000052852
AA Change: F64I

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.1e-35 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212631
Predicted Effect probably damaging
Transcript: ENSMUST00000212792
AA Change: F64I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spastic paraplegia in aged mice with reduced ER complexity in cortical motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,131,315 D212G probably damaging Het
Add1 C T 5: 34,613,295 A250V possibly damaging Het
Atxn2 A G 5: 121,777,964 N411S probably benign Het
AW551984 T C 9: 39,589,099 T788A probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddx46 A G 13: 55,669,724 T721A probably damaging Het
Eif2b1 G A 5: 124,579,108 probably benign Het
Eif4g3 A G 4: 138,177,932 K1241E probably damaging Het
Engase T A 11: 118,481,316 Y145N probably benign Het
Fbrs C A 7: 127,487,919 A674D probably damaging Het
Gm4884 G A 7: 41,044,622 G672R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iars2 T A 1: 185,288,076 I954F possibly damaging Het
Itgad A T 7: 128,185,948 I310F probably damaging Het
Kcnmb3 A G 3: 32,472,445 V199A possibly damaging Het
Kctd12 G T 14: 102,982,186 D85E probably damaging Het
Lama1 G A 17: 67,818,635 R2929H probably damaging Het
Lgmn T A 12: 102,402,692 Y176F probably benign Het
Lipo3 A G 19: 33,556,428 F335L possibly damaging Het
Map2k3 T C 11: 60,942,324 S46P probably benign Het
Megf8 C A 7: 25,358,734 H2144Q probably benign Het
Neb A T 2: 52,234,353 W3694R probably damaging Het
Nek10 A G 14: 14,861,684 E580G probably benign Het
Obscn G A 11: 59,039,009 P5930S probably damaging Het
Palld A G 8: 61,533,443 F621L probably benign Het
Pkn2 A T 3: 142,803,587 I732N probably damaging Het
Plpbp T A 8: 27,052,279 I214N possibly damaging Het
Ppp1r37 A G 7: 19,532,123 S573P probably benign Het
Prg4 C A 1: 150,460,681 C97F probably damaging Het
Prmt2 T C 10: 76,217,374 D269G possibly damaging Het
Ptbp3 T A 4: 59,517,640 L80F probably damaging Het
Srcap C A 7: 127,542,391 P1720Q probably damaging Het
Ssr1 A T 13: 37,987,690 F124I probably damaging Het
Tbx18 A G 9: 87,707,811 L358P probably damaging Het
Tfpt T C 7: 3,620,836 K71E probably benign Het
Tmem132a C A 19: 10,860,321 G542C probably damaging Het
Tmem135 A T 7: 89,307,164 L81* probably null Het
Tmem135 C A 7: 89,307,163 L81F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Washc5 A G 15: 59,340,890 probably null Het
Zfp24 T C 18: 24,017,334 E173G possibly damaging Het
Zgrf1 T C 3: 127,616,506 I1814T probably damaging Het
Other mutations in Reep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Reep1 APN 6 71773288 missense probably damaging 1.00
IGL03057:Reep1 APN 6 71807781 splice site probably benign
R1596:Reep1 UTSW 6 71756437 critical splice donor site probably null
R1899:Reep1 UTSW 6 71780797 missense probably benign 0.32
R2201:Reep1 UTSW 6 71773294 missense probably damaging 1.00
R2252:Reep1 UTSW 6 71756442 splice site probably null
R3787:Reep1 UTSW 6 71795215 missense probably damaging 0.98
R4760:Reep1 UTSW 6 71708001 missense possibly damaging 0.67
R5657:Reep1 UTSW 6 71761374 missense possibly damaging 0.89
R6619:Reep1 UTSW 6 71807842 utr 3 prime probably benign
R7080:Reep1 UTSW 6 71780765 missense possibly damaging 0.81
R7299:Reep1 UTSW 6 71761389 missense probably benign 0.02
R7730:Reep1 UTSW 6 71780741 missense possibly damaging 0.64
RF019:Reep1 UTSW 6 71707969 start codon destroyed probably null
RF023:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF029:Reep1 UTSW 6 71707966 start codon destroyed probably null
RF032:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF042:Reep1 UTSW 6 71707966 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCAAAACGAAACACGAGTTGGC -3'
(R):5'- CAACCCTTTCTACACAGGGC -3'

Sequencing Primer
(F):5'- CGAAACACGAGTTGGCTTTTAG -3'
(R):5'- GCTAGAAGCAGCATCAGT -3'
Posted On2018-07-23