Incidental Mutation 'R6659:Vmn2r111'
ID 526784
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission 044779-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6659 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22766922-22792254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22778032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 30,950,133 (GRCm39) D212G probably damaging Het
Add1 C T 5: 34,770,639 (GRCm39) A250V possibly damaging Het
Atxn2 A G 5: 121,916,027 (GRCm39) N411S probably benign Het
AW551984 T C 9: 39,500,395 (GRCm39) T788A probably benign Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Ddx46 A G 13: 55,817,537 (GRCm39) T721A probably damaging Het
Eif2b1 G A 5: 124,717,171 (GRCm39) probably benign Het
Eif4g3 A G 4: 137,905,243 (GRCm39) K1241E probably damaging Het
Engase T A 11: 118,372,142 (GRCm39) Y145N probably benign Het
Fbrs C A 7: 127,087,091 (GRCm39) A674D probably damaging Het
Gm4884 G A 7: 40,694,046 (GRCm39) G672R probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Iars2 T A 1: 185,020,273 (GRCm39) I954F possibly damaging Het
Itgad A T 7: 127,785,120 (GRCm39) I310F probably damaging Het
Kcnmb3 A G 3: 32,526,594 (GRCm39) V199A possibly damaging Het
Kctd12 G T 14: 103,219,622 (GRCm39) D85E probably damaging Het
Lama1 G A 17: 68,125,630 (GRCm39) R2929H probably damaging Het
Lgmn T A 12: 102,368,951 (GRCm39) Y176F probably benign Het
Lipo3 A G 19: 33,533,828 (GRCm39) F335L possibly damaging Het
Map2k3 T C 11: 60,833,150 (GRCm39) S46P probably benign Het
Megf8 C A 7: 25,058,159 (GRCm39) H2144Q probably benign Het
Neb A T 2: 52,124,365 (GRCm39) W3694R probably damaging Het
Nek10 A G 14: 14,861,684 (GRCm38) E580G probably benign Het
Obscn G A 11: 58,929,835 (GRCm39) P5930S probably damaging Het
Palld A G 8: 61,986,477 (GRCm39) F621L probably benign Het
Pkn2 A T 3: 142,509,348 (GRCm39) I732N probably damaging Het
Plpbp T A 8: 27,542,307 (GRCm39) I214N possibly damaging Het
Ppp1r37 A G 7: 19,266,048 (GRCm39) S573P probably benign Het
Prg4 C A 1: 150,336,432 (GRCm39) C97F probably damaging Het
Prmt2 T C 10: 76,053,208 (GRCm39) D269G possibly damaging Het
Ptbp3 T A 4: 59,517,640 (GRCm39) L80F probably damaging Het
Reep1 T A 6: 71,750,179 (GRCm39) F64I probably damaging Het
Srcap C A 7: 127,141,563 (GRCm39) P1720Q probably damaging Het
Ssr1 A T 13: 38,171,666 (GRCm39) F124I probably damaging Het
Tbx18 A G 9: 87,589,864 (GRCm39) L358P probably damaging Het
Tfpt T C 7: 3,623,835 (GRCm39) K71E probably benign Het
Tmem132a C A 19: 10,837,685 (GRCm39) G542C probably damaging Het
Tmem135 C A 7: 88,956,371 (GRCm39) L81F probably benign Het
Tmem135 A T 7: 88,956,372 (GRCm39) L81* probably null Het
Washc5 A G 15: 59,212,739 (GRCm39) probably null Het
Zfp24 T C 18: 24,150,391 (GRCm39) E173G possibly damaging Het
Zgrf1 T C 3: 127,410,155 (GRCm39) I1814T probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22,767,734 (GRCm39) missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22,787,965 (GRCm39) missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22,787,997 (GRCm39) missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22,790,966 (GRCm39) nonsense probably null
IGL01465:Vmn2r111 APN 17 22,767,718 (GRCm39) missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22,767,553 (GRCm39) missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22,790,373 (GRCm39) missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22,788,054 (GRCm39) splice site probably benign
IGL01962:Vmn2r111 APN 17 22,767,265 (GRCm39) missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22,789,754 (GRCm39) missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22,787,837 (GRCm39) missense probably benign
IGL02519:Vmn2r111 APN 17 22,767,320 (GRCm39) missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22,790,031 (GRCm39) missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22,792,205 (GRCm39) missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22,778,023 (GRCm39) critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22,790,226 (GRCm39) missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22,789,839 (GRCm39) missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22,766,990 (GRCm39) missense probably benign
R0064:Vmn2r111 UTSW 17 22,791,053 (GRCm39) missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22,792,102 (GRCm39) missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22,790,097 (GRCm39) missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22,790,028 (GRCm39) missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22,790,380 (GRCm39) missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22,788,042 (GRCm39) missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22,767,041 (GRCm39) missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22,767,062 (GRCm39) missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22,767,395 (GRCm39) missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22,778,043 (GRCm39) missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22,792,085 (GRCm39) missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22,778,151 (GRCm39) splice site probably benign
R3700:Vmn2r111 UTSW 17 22,790,142 (GRCm39) nonsense probably null
R3782:Vmn2r111 UTSW 17 22,790,301 (GRCm39) missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22,778,096 (GRCm39) missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22,792,159 (GRCm39) missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22,767,637 (GRCm39) missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22,767,022 (GRCm39) missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22,790,124 (GRCm39) missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22,790,001 (GRCm39) missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22,767,083 (GRCm39) nonsense probably null
R5398:Vmn2r111 UTSW 17 22,792,252 (GRCm39) start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22,767,470 (GRCm39) missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22,767,238 (GRCm39) missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6149:Vmn2r111 UTSW 17 22,767,796 (GRCm39) missense probably benign 0.00
R6207:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22,792,070 (GRCm39) missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22,790,889 (GRCm39) missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22,767,583 (GRCm39) missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22,790,226 (GRCm39) missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22,767,165 (GRCm39) missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22,767,695 (GRCm39) missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22,790,067 (GRCm39) missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22,767,380 (GRCm39) missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22,789,714 (GRCm39) missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22,792,083 (GRCm39) missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22,790,469 (GRCm39) missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22,792,073 (GRCm39) missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22,778,032 (GRCm39) missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22,767,562 (GRCm39) missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22,790,274 (GRCm39) missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22,778,024 (GRCm39) missense probably damaging 1.00
R8540:Vmn2r111 UTSW 17 22,778,023 (GRCm39) critical splice donor site probably null
R8557:Vmn2r111 UTSW 17 22,790,910 (GRCm39) nonsense probably null
R8720:Vmn2r111 UTSW 17 22,792,194 (GRCm39) missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22,767,239 (GRCm39) missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22,767,011 (GRCm39) missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22,790,822 (GRCm39) missense probably benign
R9374:Vmn2r111 UTSW 17 22,787,859 (GRCm39) missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22,778,132 (GRCm39) missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22,767,676 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2018-07-23