Incidental Mutation 'R6659:Vmn2r111'
ID 526784
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R6659 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22547941-22573273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22559051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,131,315 D212G probably damaging Het
Add1 C T 5: 34,613,295 A250V possibly damaging Het
Atxn2 A G 5: 121,777,964 N411S probably benign Het
AW551984 T C 9: 39,589,099 T788A probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Ddx46 A G 13: 55,669,724 T721A probably damaging Het
Eif2b1 G A 5: 124,579,108 probably benign Het
Eif4g3 A G 4: 138,177,932 K1241E probably damaging Het
Engase T A 11: 118,481,316 Y145N probably benign Het
Fbrs C A 7: 127,487,919 A674D probably damaging Het
Gm4884 G A 7: 41,044,622 G672R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iars2 T A 1: 185,288,076 I954F possibly damaging Het
Itgad A T 7: 128,185,948 I310F probably damaging Het
Kcnmb3 A G 3: 32,472,445 V199A possibly damaging Het
Kctd12 G T 14: 102,982,186 D85E probably damaging Het
Lama1 G A 17: 67,818,635 R2929H probably damaging Het
Lgmn T A 12: 102,402,692 Y176F probably benign Het
Lipo3 A G 19: 33,556,428 F335L possibly damaging Het
Map2k3 T C 11: 60,942,324 S46P probably benign Het
Megf8 C A 7: 25,358,734 H2144Q probably benign Het
Neb A T 2: 52,234,353 W3694R probably damaging Het
Nek10 A G 14: 14,861,684 E580G probably benign Het
Obscn G A 11: 59,039,009 P5930S probably damaging Het
Palld A G 8: 61,533,443 F621L probably benign Het
Pkn2 A T 3: 142,803,587 I732N probably damaging Het
Plpbp T A 8: 27,052,279 I214N possibly damaging Het
Ppp1r37 A G 7: 19,532,123 S573P probably benign Het
Prg4 C A 1: 150,460,681 C97F probably damaging Het
Prmt2 T C 10: 76,217,374 D269G possibly damaging Het
Ptbp3 T A 4: 59,517,640 L80F probably damaging Het
Reep1 T A 6: 71,773,195 F64I probably damaging Het
Srcap C A 7: 127,542,391 P1720Q probably damaging Het
Ssr1 A T 13: 37,987,690 F124I probably damaging Het
Tbx18 A G 9: 87,707,811 L358P probably damaging Het
Tfpt T C 7: 3,620,836 K71E probably benign Het
Tmem132a C A 19: 10,860,321 G542C probably damaging Het
Tmem135 C A 7: 89,307,163 L81F probably benign Het
Tmem135 A T 7: 89,307,164 L81* probably null Het
Washc5 A G 15: 59,340,890 probably null Het
Zfp24 T C 18: 24,017,334 E173G possibly damaging Het
Zgrf1 T C 3: 127,616,506 I1814T probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22548030 missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22571841 missense probably benign
R9374:Vmn2r111 UTSW 17 22568878 missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22559151 missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2018-07-23