Incidental Mutation 'R6659:Zfp24'
ID526786
Institutional Source Beutler Lab
Gene Symbol Zfp24
Ensembl Gene ENSMUSG00000051469
Gene Namezinc finger protein 24
SynonymsZF-12, Zfp191, KOX17, 3526401F17Rik, 5033419P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6659 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location24009702-24020810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24017334 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000122579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066497] [ENSMUST00000148525] [ENSMUST00000153337]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066497
AA Change: E173G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064637
Gene: ENSMUSG00000051469
AA Change: E173G

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148525
Predicted Effect possibly damaging
Transcript: ENSMUST00000153337
AA Change: E173G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122579
Gene: ENSMUSG00000051469
AA Change: E173G

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for one mutation have hypomyelination of the central nervous system, tremors, tonic seizures and premature death, whereas mice homozygous null for another mutation are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,131,315 D212G probably damaging Het
Add1 C T 5: 34,613,295 A250V possibly damaging Het
Atxn2 A G 5: 121,777,964 N411S probably benign Het
AW551984 T C 9: 39,589,099 T788A probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddx46 A G 13: 55,669,724 T721A probably damaging Het
Eif2b1 G A 5: 124,579,108 probably benign Het
Eif4g3 A G 4: 138,177,932 K1241E probably damaging Het
Engase T A 11: 118,481,316 Y145N probably benign Het
Fbrs C A 7: 127,487,919 A674D probably damaging Het
Gm4884 G A 7: 41,044,622 G672R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iars2 T A 1: 185,288,076 I954F possibly damaging Het
Itgad A T 7: 128,185,948 I310F probably damaging Het
Kcnmb3 A G 3: 32,472,445 V199A possibly damaging Het
Kctd12 G T 14: 102,982,186 D85E probably damaging Het
Lama1 G A 17: 67,818,635 R2929H probably damaging Het
Lgmn T A 12: 102,402,692 Y176F probably benign Het
Lipo3 A G 19: 33,556,428 F335L possibly damaging Het
Map2k3 T C 11: 60,942,324 S46P probably benign Het
Megf8 C A 7: 25,358,734 H2144Q probably benign Het
Neb A T 2: 52,234,353 W3694R probably damaging Het
Nek10 A G 14: 14,861,684 E580G probably benign Het
Obscn G A 11: 59,039,009 P5930S probably damaging Het
Palld A G 8: 61,533,443 F621L probably benign Het
Pkn2 A T 3: 142,803,587 I732N probably damaging Het
Plpbp T A 8: 27,052,279 I214N possibly damaging Het
Ppp1r37 A G 7: 19,532,123 S573P probably benign Het
Prg4 C A 1: 150,460,681 C97F probably damaging Het
Prmt2 T C 10: 76,217,374 D269G possibly damaging Het
Ptbp3 T A 4: 59,517,640 L80F probably damaging Het
Reep1 T A 6: 71,773,195 F64I probably damaging Het
Srcap C A 7: 127,542,391 P1720Q probably damaging Het
Ssr1 A T 13: 37,987,690 F124I probably damaging Het
Tbx18 A G 9: 87,707,811 L358P probably damaging Het
Tfpt T C 7: 3,620,836 K71E probably benign Het
Tmem132a C A 19: 10,860,321 G542C probably damaging Het
Tmem135 A T 7: 89,307,164 L81* probably null Het
Tmem135 C A 7: 89,307,163 L81F probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Washc5 A G 15: 59,340,890 probably null Het
Zgrf1 T C 3: 127,616,506 I1814T probably damaging Het
Other mutations in Zfp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02750:Zfp24 APN 18 24017353 missense possibly damaging 0.48
R1573:Zfp24 UTSW 18 24017342 missense possibly damaging 0.70
R1946:Zfp24 UTSW 18 24014419 frame shift probably null
R2508:Zfp24 UTSW 18 24017870 missense probably damaging 1.00
R2845:Zfp24 UTSW 18 24017828 missense probably damaging 0.99
R4119:Zfp24 UTSW 18 24014569 missense possibly damaging 0.86
R4471:Zfp24 UTSW 18 24018115 start gained probably benign
R5847:Zfp24 UTSW 18 24018038 missense possibly damaging 0.93
R6091:Zfp24 UTSW 18 24014212 missense probably damaging 1.00
Y4338:Zfp24 UTSW 18 24017855 missense possibly damaging 0.55
Y4338:Zfp24 UTSW 18 24017868 missense probably damaging 1.00
Y5409:Zfp24 UTSW 18 24017855 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AACGATGGTAATGTCTGGGAGC -3'
(R):5'- GCTAGCTAGGATTCTCGTGTC -3'

Sequencing Primer
(F):5'- AATACCTAAGGCCAATGAATCAATC -3'
(R):5'- CTAGGATTCTCGTGTCTCTGTATAG -3'
Posted On2018-07-23