Incidental Mutation 'R6660:Sh3bp4'
ID 526789
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6660 (G1)
Quality Score 183.009
Status Not validated
Chromosome 1
Chromosomal Location 89070415-89155068 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89153166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 902 (S902G)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect possibly damaging
Transcript: ENSMUST00000066279
AA Change: S902G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: S902G

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89143960 missense probably benign
IGL01344:Sh3bp4 APN 1 89153236 missense probably benign
IGL02025:Sh3bp4 APN 1 89145286 missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89143690 missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89145148 missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89153163 missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89143544 splice site probably benign
IGL03327:Sh3bp4 APN 1 89144163 nonsense probably null
I0000:Sh3bp4 UTSW 1 89137796 missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89145434 missense probably benign
R0128:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89145314 missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89143772 missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89145488 missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89145592 missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89145047 missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89137705 missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89145328 missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89145869 missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89144273 missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89145595 missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89144240 missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89137734 missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89144275 missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89145350 missense probably benign
R5908:Sh3bp4 UTSW 1 89145883 missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89145489 missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89144921 missense possibly damaging 0.78
R6900:Sh3bp4 UTSW 1 89145767 missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89153102 splice site probably null
R7320:Sh3bp4 UTSW 1 89145494 missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89144448 missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89145646 missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89145315 missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89145575 missense probably benign 0.45
R8915:Sh3bp4 UTSW 1 89152342 missense probably damaging 0.99
R8953:Sh3bp4 UTSW 1 89144437 missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89144925 nonsense probably null
R9718:Sh3bp4 UTSW 1 89145750 missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89145022 missense probably benign
Z1176:Sh3bp4 UTSW 1 89145728 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCTCATGACTCGGACACAGG -3'
(R):5'- AAAGTCATCATGGTCCGCG -3'

Sequencing Primer
(F):5'- TAGGCTAGGTTGCACTAAGGGC -3'
(R):5'- CGGGACTGAAGGCAGCTG -3'
Posted On 2018-07-23