Incidental Mutation 'R6660:Pdc'
ID526790
Institutional Source Beutler Lab
Gene Symbol Pdc
Ensembl Gene ENSMUSG00000006007
Gene Namephosducin
SynonymsPdc, Rpr1, Rpr-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location150319417-150333906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150333335 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 190 (Y190H)
Ref Sequence ENSEMBL: ENSMUSP00000141136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165062] [ENSMUST00000185698] [ENSMUST00000186572] [ENSMUST00000191228]
Predicted Effect probably damaging
Transcript: ENSMUST00000165062
AA Change: Y190H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131631
Gene: ENSMUSG00000006007
AA Change: Y190H

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185698
SMART Domains Protein: ENSMUSP00000140669
Gene: ENSMUSG00000006007

DomainStartEndE-ValueType
Pfam:Phosducin 1 79 2.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186460
Predicted Effect probably benign
Transcript: ENSMUST00000186572
SMART Domains Protein: ENSMUSP00000140843
Gene: ENSMUSG00000006007

DomainStartEndE-ValueType
Pfam:Phosducin 1 185 1.6e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191228
AA Change: Y190H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141136
Gene: ENSMUSG00000006007
AA Change: Y190H

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal retinal morphology and rod function with reduced transducin (Gnat1) translocation. Mice homozygous for a different knock-out allele exhibit large pupils, increased blood pressure, age-related vascular smooth muscle hypertrophy, and stress-induced hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Pdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Pdc APN 1 150333255 missense probably damaging 0.99
IGL02537:Pdc APN 1 150333009 missense possibly damaging 0.68
R0349:Pdc UTSW 1 150333427 missense probably benign 0.07
R0502:Pdc UTSW 1 150328414 splice site probably benign
R1167:Pdc UTSW 1 150333245 missense probably damaging 1.00
R1717:Pdc UTSW 1 150333141 missense probably damaging 1.00
R5182:Pdc UTSW 1 150333354 missense possibly damaging 0.84
R5449:Pdc UTSW 1 150333439 missense probably damaging 1.00
R5766:Pdc UTSW 1 150333500 makesense probably null
R6020:Pdc UTSW 1 150333366 missense probably benign 0.16
R6181:Pdc UTSW 1 150333270 missense probably damaging 1.00
R6425:Pdc UTSW 1 150333372 missense probably benign 0.37
R6717:Pdc UTSW 1 150333018 missense probably damaging 1.00
R6925:Pdc UTSW 1 150333180 missense probably damaging 1.00
R7716:Pdc UTSW 1 150330783 missense probably benign 0.06
R7820:Pdc UTSW 1 150333270 missense probably damaging 1.00
R8030:Pdc UTSW 1 150333213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGAGCAATTCCTGGAAAC -3'
(R):5'- ACTGACATGGTGAAGGCTTATTC -3'

Sequencing Primer
(F):5'- GGAGCAATTCCTGGAAACCATCG -3'
(R):5'- GAAGGCTTATTCAATGTCCTCG -3'
Posted On2018-07-23