Incidental Mutation 'R6660:Ube2l6'
ID526795
Institutional Source Beutler Lab
Gene Symbol Ube2l6
Ensembl Gene ENSMUSG00000027078
Gene Nameubiquitin-conjugating enzyme E2L 6
Synonyms2810489I21Rik, UBCH8, Ubce8, Ubcm8, RIG-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84798828-84810335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84806508 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 99 (T99A)
Ref Sequence ENSEMBL: ENSMUSP00000099702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028471] [ENSMUST00000102642] [ENSMUST00000150325]
Predicted Effect probably benign
Transcript: ENSMUST00000028471
SMART Domains Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077

DomainStartEndE-ValueType
low complexity region 56 72 N/A INTRINSIC
coiled coil region 124 154 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 260 285 N/A INTRINSIC
CH 345 444 5.55e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102642
AA Change: T99A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099702
Gene: ENSMUSG00000027078
AA Change: T99A

DomainStartEndE-ValueType
UBCc 5 149 1.03e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150325
SMART Domains Protein: ENSMUSP00000119507
Gene: ENSMUSG00000027078

DomainStartEndE-ValueType
PDB:2KJH|A 1 88 6e-18 PDB
SCOP:d1c4zd_ 3 40 7e-7 SMART
Blast:UBCc 4 89 4e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159150
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Ube2l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ube2l6 APN 2 84809038 missense possibly damaging 0.79
IGL00592:Ube2l6 APN 2 84809029 missense probably damaging 1.00
IGL02000:Ube2l6 APN 2 84809162 unclassified probably benign
IGL02931:Ube2l6 APN 2 84802851 missense probably damaging 0.99
R0129:Ube2l6 UTSW 2 84798908 start codon destroyed probably null 0.17
R0277:Ube2l6 UTSW 2 84806427 unclassified probably null
R1612:Ube2l6 UTSW 2 84806373 missense probably damaging 1.00
R3923:Ube2l6 UTSW 2 84809074 missense possibly damaging 0.85
R5137:Ube2l6 UTSW 2 84802876 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGATCAGGACCAGCTTCCC -3'
(R):5'- GTGAGCCTTTTCATCAGCTAAATC -3'

Sequencing Primer
(F):5'- ATCAGGACCAGCTTCCCTATGG -3'
(R):5'- TCCCAAGTGTTGAGATCCCAAGTG -3'
Posted On2018-07-23