Incidental Mutation 'R6660:Fam227b'
ID526796
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Namefamily with sequence similarity 227, member B
Synonyms4930525F21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125983483-126152004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 126144307 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 13 (P13Q)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
Predicted Effect probably damaging
Transcript: ENSMUST00000110446
AA Change: P13Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: P13Q

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110448
AA Change: P13Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: P13Q

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably damaging
Transcript: ENSMUST00000178118
AA Change: P13Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: P13Q

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Mice homozygous for a knock-out allele exhibit abnormal coat appearance, abnormal kidney morphology, spleen hypoplasia, decreased vesicles clustering in GABAergic synapses, decreased miniature inhibitory postsynaptic currents, and increased susceptibility to drug-induced seizures.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 126144325 critical splice acceptor site probably null
IGL00970:Fam227b APN 2 126127060 missense probably benign 0.01
IGL02040:Fam227b APN 2 126121084 splice site probably benign
IGL02095:Fam227b APN 2 126101004 missense probably damaging 0.97
IGL02352:Fam227b APN 2 126146254 unclassified probably benign
IGL02359:Fam227b APN 2 126146254 unclassified probably benign
IGL02506:Fam227b APN 2 126003911 missense probably benign 0.22
IGL02717:Fam227b APN 2 126003843 missense probably null 0.97
IGL02933:Fam227b APN 2 126123988 splice site probably null
IGL03064:Fam227b APN 2 126126842 splice site probably null
IGL03086:Fam227b APN 2 126119031 missense probably benign 0.01
IGL03198:Fam227b APN 2 126124579 critical splice donor site probably null
IGL03256:Fam227b APN 2 125989003 missense probably damaging 0.99
IGL03368:Fam227b APN 2 126119063 missense probably damaging 1.00
dana UTSW 2 126116123 missense probably damaging 1.00
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0071:Fam227b UTSW 2 126124074 missense probably benign 0.04
R0110:Fam227b UTSW 2 126100921 missense probably damaging 1.00
R0140:Fam227b UTSW 2 126124603 missense possibly damaging 0.53
R0377:Fam227b UTSW 2 126125000 splice site probably benign
R0499:Fam227b UTSW 2 126100909 missense probably benign 0.25
R1240:Fam227b UTSW 2 126124585 missense possibly damaging 0.56
R1356:Fam227b UTSW 2 126119008 missense probably damaging 1.00
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R1404:Fam227b UTSW 2 126003839 missense probably damaging 0.99
R2055:Fam227b UTSW 2 126100954 missense probably benign 0.13
R2884:Fam227b UTSW 2 126100926 missense probably benign 0.01
R3124:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3125:Fam227b UTSW 2 126124086 missense probably benign 0.36
R3937:Fam227b UTSW 2 126127060 missense probably benign 0.01
R4408:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4454:Fam227b UTSW 2 126146268 unclassified probably benign
R4455:Fam227b UTSW 2 126146268 unclassified probably benign
R4457:Fam227b UTSW 2 126146268 unclassified probably benign
R4558:Fam227b UTSW 2 126127043 missense probably benign 0.00
R4661:Fam227b UTSW 2 126007310 missense probably damaging 0.99
R4809:Fam227b UTSW 2 126116125 missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125987939 missense probably benign 0.01
R4989:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5011:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5013:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5014:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5133:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5184:Fam227b UTSW 2 126116123 missense probably damaging 1.00
R5431:Fam227b UTSW 2 126126931 missense probably benign 0.09
R5797:Fam227b UTSW 2 126007334 missense probably benign
R6056:Fam227b UTSW 2 126121052 missense probably damaging 1.00
R6218:Fam227b UTSW 2 126126962 missense probably damaging 1.00
R6471:Fam227b UTSW 2 126121065 missense probably damaging 1.00
R6734:Fam227b UTSW 2 126126976 nonsense probably null
R7136:Fam227b UTSW 2 126124028 missense probably damaging 0.99
R7410:Fam227b UTSW 2 126119063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTTCACAGAACTGTATGCAC -3'
(R):5'- CAGTGTGTGGACTCTACAAAGC -3'

Sequencing Primer
(F):5'- CAGGATTCAATGTCAGACACTG -3'
(R):5'- GTGTGGACTCTACAAAGCACACAATG -3'
Posted On2018-07-23