Incidental Mutation 'R6660:Ergic3'
List |< first << previous [record 10 of 33] next >> last >|
ID526798
Institutional Source Beutler Lab
Gene Symbol Ergic3
Ensembl Gene ENSMUSG00000005881
Gene NameERGIC and golgi 3
SynonymsD2Ucla1, NY-BR-84, CGI-54, Sdbcag84, 2310015B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156008045-156018279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156017834 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 227 (I227V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006035] [ENSMUST00000088650] [ENSMUST00000109611]
Predicted Effect probably benign
Transcript: ENSMUST00000006035
AA Change: I352V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000006035
Gene: ENSMUSG00000005881
AA Change: I352V

DomainStartEndE-ValueType
Pfam:ERGIC_N 6 101 2.2e-38 PFAM
Pfam:COPIIcoated_ERV 145 363 6.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088650
AA Change: I363V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000086025
Gene: ENSMUSG00000005881
AA Change: I363V

DomainStartEndE-ValueType
Pfam:ERGIC_N 7 97 9e-35 PFAM
Pfam:COPIIcoated_ERV 145 374 7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109611
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138297
Predicted Effect probably benign
Transcript: ENSMUST00000142859
SMART Domains Protein: ENSMUSP00000115912
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 74 246 1.9e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152568
Predicted Effect probably damaging
Transcript: ENSMUST00000155370
AA Change: I227V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119051
Gene: ENSMUSG00000005881
AA Change: I227V

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 21 235 1e-95 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Ergic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02089:Ergic3 APN 2 156010475 missense probably benign
IGL02792:Ergic3 APN 2 156017850 missense probably damaging 1.00
R0128:Ergic3 UTSW 2 156011140 missense possibly damaging 0.79
R0389:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R0443:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R1116:Ergic3 UTSW 2 156016787 missense probably benign 0.07
R2005:Ergic3 UTSW 2 156011108 missense possibly damaging 0.85
R2230:Ergic3 UTSW 2 156017816 missense probably damaging 1.00
R2232:Ergic3 UTSW 2 156017816 missense probably damaging 1.00
R4975:Ergic3 UTSW 2 156017718 critical splice donor site probably null
R5103:Ergic3 UTSW 2 156008625 missense probably benign 0.37
R5285:Ergic3 UTSW 2 156018037 unclassified probably benign
R6624:Ergic3 UTSW 2 156016898 missense probably damaging 1.00
R7094:Ergic3 UTSW 2 156016763 missense possibly damaging 0.85
X0027:Ergic3 UTSW 2 156008611 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCACGAGAAGGTTGCCAATG -3'
(R):5'- AGCATTTTCCTTGGTCCTTAAGG -3'

Sequencing Primer
(F):5'- AATGGGCTCCTGGGTGAC -3'
(R):5'- AAGGCATTCCTCTTCCCCAG -3'
Posted On2018-07-23