Incidental Mutation 'R6660:Syt6'
ID 526800
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Name synaptotagmin VI
Synonyms 3110037A08Rik
MMRRC Submission 044780-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R6660 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 103482561-103552883 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 103532960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 363 (L363R)
Ref Sequence ENSEMBL: ENSMUSP00000113373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985]
AlphaFold Q9R0N8
Predicted Effect possibly damaging
Transcript: ENSMUST00000090697
AA Change: L448R

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: L448R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117221
AA Change: L363R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: L363R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118117
AA Change: L363R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: L363R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118563
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121834
AA Change: L448R

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: L448R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,237,581 (GRCm39) I289N probably damaging Het
Atg5 A G 10: 44,170,651 (GRCm39) N99S probably benign Het
Ccdc88a A G 11: 29,432,663 (GRCm39) Q1223R probably benign Het
Cdc42 T C 4: 137,056,145 (GRCm39) D122G probably benign Het
Cpxm1 A G 2: 130,238,069 (GRCm39) S127P probably damaging Het
Cyfip2 A G 11: 46,140,634 (GRCm39) C730R possibly damaging Het
Ddx60 T A 8: 62,409,273 (GRCm39) H436Q probably benign Het
Dnah17 T C 11: 117,991,014 (GRCm39) Y1236C probably benign Het
Ep400 G A 5: 110,867,313 (GRCm39) R1000* probably null Het
Ergic3 A G 2: 155,859,754 (GRCm39) I227V probably damaging Het
Fam227b G T 2: 125,986,227 (GRCm39) P13Q probably damaging Het
Gal A G 19: 3,460,108 (GRCm39) L121P possibly damaging Het
Garin2 T C 12: 78,762,131 (GRCm39) V265A possibly damaging Het
Ifi207 T C 1: 173,556,972 (GRCm39) T589A probably benign Het
Intu T C 3: 40,586,100 (GRCm39) V27A probably benign Het
Lama1 A T 17: 68,111,495 (GRCm39) I2249L probably benign Het
Pdc T C 1: 150,209,086 (GRCm39) Y190H probably damaging Het
Pmm2 T C 16: 8,473,506 (GRCm39) L240P probably damaging Het
Polr1a T C 6: 71,944,358 (GRCm39) V1275A probably damaging Het
Rgsl1 T A 1: 153,701,512 (GRCm39) N314I possibly damaging Het
Rpe65 A T 3: 159,320,345 (GRCm39) N301Y probably damaging Het
Ryr1 A G 7: 28,737,770 (GRCm39) probably null Het
Sh3bp4 A G 1: 89,080,888 (GRCm39) S902G possibly damaging Het
Slc44a4 A T 17: 35,149,201 (GRCm39) R705W probably damaging Het
Slc4a10 A G 2: 62,080,747 (GRCm39) I325V possibly damaging Het
Spns1 A G 7: 125,974,237 (GRCm39) probably null Het
Ttn A G 2: 76,544,759 (GRCm39) V32781A probably benign Het
Ube2l6 A G 2: 84,636,852 (GRCm39) T99A probably damaging Het
Unc13b A T 4: 43,177,412 (GRCm39) probably benign Het
Vmn1r189 A T 13: 22,286,066 (GRCm39) L257H possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zfpm2 T C 15: 40,518,981 (GRCm39) probably null Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103,532,942 (GRCm39) missense probably damaging 0.98
IGL02944:Syt6 APN 3 103,482,865 (GRCm39) unclassified probably benign
IGL03168:Syt6 APN 3 103,494,943 (GRCm39) missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103,482,769 (GRCm39) missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103,494,842 (GRCm39) missense probably damaging 1.00
R0587:Syt6 UTSW 3 103,532,887 (GRCm39) missense probably damaging 0.99
R0601:Syt6 UTSW 3 103,528,206 (GRCm39) missense probably damaging 1.00
R1262:Syt6 UTSW 3 103,492,656 (GRCm39) critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103,494,736 (GRCm39) missense probably benign 0.21
R4012:Syt6 UTSW 3 103,532,809 (GRCm39) splice site probably benign
R4450:Syt6 UTSW 3 103,492,961 (GRCm39) missense probably benign 0.01
R4493:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4494:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4495:Syt6 UTSW 3 103,494,876 (GRCm39) nonsense probably null
R4740:Syt6 UTSW 3 103,532,972 (GRCm39) missense probably damaging 1.00
R4750:Syt6 UTSW 3 103,538,233 (GRCm39) makesense probably null
R5668:Syt6 UTSW 3 103,528,217 (GRCm39) missense probably damaging 1.00
R6185:Syt6 UTSW 3 103,492,844 (GRCm39) missense probably damaging 1.00
R7120:Syt6 UTSW 3 103,494,673 (GRCm39) missense probably damaging 1.00
R7307:Syt6 UTSW 3 103,494,788 (GRCm39) missense probably damaging 1.00
R7501:Syt6 UTSW 3 103,495,018 (GRCm39) missense probably benign 0.01
R8768:Syt6 UTSW 3 103,492,850 (GRCm39) missense probably benign
R8867:Syt6 UTSW 3 103,534,371 (GRCm39) missense possibly damaging 0.91
R8885:Syt6 UTSW 3 103,532,941 (GRCm39) missense probably benign 0.06
R9068:Syt6 UTSW 3 103,494,825 (GRCm39) nonsense probably null
R9098:Syt6 UTSW 3 103,492,895 (GRCm39) missense probably damaging 0.96
R9361:Syt6 UTSW 3 103,482,679 (GRCm39) unclassified probably benign
Z1177:Syt6 UTSW 3 103,552,431 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CATCCCAAATCGGTTTAACCTC -3'
(R):5'- ATTACCCCAGGCTGGAAAGG -3'

Sequencing Primer
(F):5'- ATCCCAAATCGGTTTAACCTCTTATC -3'
(R):5'- CTGTAGCTTTTAGTAAGGATGGTCC -3'
Posted On 2018-07-23