Incidental Mutation 'R6660:Syt6'
List |< first << previous [record 27 of 33] next >> last >|
ID526800
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Namesynaptotagmin VI
Synonyms3110037A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103575231-103645569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103625644 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 363 (L363R)
Ref Sequence ENSEMBL: ENSMUSP00000113373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090697
AA Change: L448R

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: L448R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117221
AA Change: L363R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: L363R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118117
AA Change: L363R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: L363R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118563
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121834
AA Change: L448R

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: L448R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103625626 missense probably damaging 0.98
IGL02944:Syt6 APN 3 103575549 unclassified probably benign
IGL03168:Syt6 APN 3 103587627 missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103575453 missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103587526 missense probably damaging 1.00
R0587:Syt6 UTSW 3 103625571 missense probably damaging 0.99
R0601:Syt6 UTSW 3 103620890 missense probably damaging 1.00
R1262:Syt6 UTSW 3 103585340 critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103587420 missense probably benign 0.21
R4012:Syt6 UTSW 3 103625493 splice site probably benign
R4450:Syt6 UTSW 3 103585645 missense probably benign 0.01
R4493:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4494:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4495:Syt6 UTSW 3 103587560 nonsense probably null
R4740:Syt6 UTSW 3 103625656 missense probably damaging 1.00
R4750:Syt6 UTSW 3 103630917 makesense probably null
R5668:Syt6 UTSW 3 103620901 missense probably damaging 1.00
R6185:Syt6 UTSW 3 103585528 missense probably damaging 1.00
R7120:Syt6 UTSW 3 103587357 missense probably damaging 1.00
R7307:Syt6 UTSW 3 103587472 missense probably damaging 1.00
R7501:Syt6 UTSW 3 103587702 missense probably benign 0.01
Z1177:Syt6 UTSW 3 103645115 missense unknown
Predicted Primers PCR Primer
(F):5'- CATCCCAAATCGGTTTAACCTC -3'
(R):5'- ATTACCCCAGGCTGGAAAGG -3'

Sequencing Primer
(F):5'- ATCCCAAATCGGTTTAACCTCTTATC -3'
(R):5'- CTGTAGCTTTTAGTAAGGATGGTCC -3'
Posted On2018-07-23