Incidental Mutation 'R6660:Cdc42'
ID 526803
Institutional Source Beutler Lab
Gene Symbol Cdc42
Ensembl Gene ENSMUSG00000006699
Gene Name cell division cycle 42
Synonyms
MMRRC Submission 044780-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6660 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 137047007-137085031 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137056145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000054634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030417] [ENSMUST00000051477]
AlphaFold P60766
Predicted Effect probably benign
Transcript: ENSMUST00000030417
AA Change: D122G

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030417
Gene: ENSMUSG00000006699
AA Change: D122G

DomainStartEndE-ValueType
RHO 6 179 1.29e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051477
AA Change: D122G

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054634
Gene: ENSMUSG00000006699
AA Change: D122G

DomainStartEndE-ValueType
RHO 6 179 9.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158574
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele are small, lack primary ectoderm, exhibit disorganized embryonic tissue and die before somite formation. Mice homozygous for a gene trapped allele die at E3.5-E7.5. Mice heterozygous for a targeted allele show reduced ventricle muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,237,581 (GRCm39) I289N probably damaging Het
Atg5 A G 10: 44,170,651 (GRCm39) N99S probably benign Het
Ccdc88a A G 11: 29,432,663 (GRCm39) Q1223R probably benign Het
Cpxm1 A G 2: 130,238,069 (GRCm39) S127P probably damaging Het
Cyfip2 A G 11: 46,140,634 (GRCm39) C730R possibly damaging Het
Ddx60 T A 8: 62,409,273 (GRCm39) H436Q probably benign Het
Dnah17 T C 11: 117,991,014 (GRCm39) Y1236C probably benign Het
Ep400 G A 5: 110,867,313 (GRCm39) R1000* probably null Het
Ergic3 A G 2: 155,859,754 (GRCm39) I227V probably damaging Het
Fam227b G T 2: 125,986,227 (GRCm39) P13Q probably damaging Het
Gal A G 19: 3,460,108 (GRCm39) L121P possibly damaging Het
Garin2 T C 12: 78,762,131 (GRCm39) V265A possibly damaging Het
Ifi207 T C 1: 173,556,972 (GRCm39) T589A probably benign Het
Intu T C 3: 40,586,100 (GRCm39) V27A probably benign Het
Lama1 A T 17: 68,111,495 (GRCm39) I2249L probably benign Het
Pdc T C 1: 150,209,086 (GRCm39) Y190H probably damaging Het
Pmm2 T C 16: 8,473,506 (GRCm39) L240P probably damaging Het
Polr1a T C 6: 71,944,358 (GRCm39) V1275A probably damaging Het
Rgsl1 T A 1: 153,701,512 (GRCm39) N314I possibly damaging Het
Rpe65 A T 3: 159,320,345 (GRCm39) N301Y probably damaging Het
Ryr1 A G 7: 28,737,770 (GRCm39) probably null Het
Sh3bp4 A G 1: 89,080,888 (GRCm39) S902G possibly damaging Het
Slc44a4 A T 17: 35,149,201 (GRCm39) R705W probably damaging Het
Slc4a10 A G 2: 62,080,747 (GRCm39) I325V possibly damaging Het
Spns1 A G 7: 125,974,237 (GRCm39) probably null Het
Syt6 T G 3: 103,532,960 (GRCm39) L363R probably damaging Het
Ttn A G 2: 76,544,759 (GRCm39) V32781A probably benign Het
Ube2l6 A G 2: 84,636,852 (GRCm39) T99A probably damaging Het
Unc13b A T 4: 43,177,412 (GRCm39) probably benign Het
Vmn1r189 A T 13: 22,286,066 (GRCm39) L257H possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zfpm2 T C 15: 40,518,981 (GRCm39) probably null Het
Other mutations in Cdc42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Cdc42 APN 4 137,063,381 (GRCm39) missense probably benign 0.00
R4883:Cdc42 UTSW 4 137,056,115 (GRCm39) missense probably benign 0.00
R6932:Cdc42 UTSW 4 137,049,932 (GRCm39) critical splice acceptor site probably null
R8292:Cdc42 UTSW 4 137,063,384 (GRCm39) missense probably benign
R8376:Cdc42 UTSW 4 137,056,205 (GRCm39) missense probably benign 0.07
R9244:Cdc42 UTSW 4 137,056,391 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TGTACTCTGCAGAACTACACTCAC -3'
(R):5'- TGCCCTTTGAAACATGCACAG -3'

Sequencing Primer
(F):5'- GGAAAGAGCCTCTGTATCCTAATGC -3'
(R):5'- AGAATTCCTGTTGCCCTGTTACAG -3'
Posted On 2018-07-23