Incidental Mutation 'R6660:Cdc42'
ID526803
Institutional Source Beutler Lab
Gene Symbol Cdc42
Ensembl Gene ENSMUSG00000006699
Gene Namecell division cycle 42
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location137319696-137357720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137328834 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 122 (D122G)
Ref Sequence ENSEMBL: ENSMUSP00000054634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030417] [ENSMUST00000051477]
Predicted Effect probably benign
Transcript: ENSMUST00000030417
AA Change: D122G

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030417
Gene: ENSMUSG00000006699
AA Change: D122G

DomainStartEndE-ValueType
RHO 6 179 1.29e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051477
AA Change: D122G

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054634
Gene: ENSMUSG00000006699
AA Change: D122G

DomainStartEndE-ValueType
RHO 6 179 9.09e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158574
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele are small, lack primary ectoderm, exhibit disorganized embryonic tissue and die before somite formation. Mice homozygous for a gene trapped allele die at E3.5-E7.5. Mice heterozygous for a targeted allele show reduced ventricle muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Cdc42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Cdc42 APN 4 137336070 missense probably benign 0.00
R4883:Cdc42 UTSW 4 137328804 missense probably benign 0.00
R6932:Cdc42 UTSW 4 137322621 critical splice acceptor site probably null
R8292:Cdc42 UTSW 4 137336073 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTACTCTGCAGAACTACACTCAC -3'
(R):5'- TGCCCTTTGAAACATGCACAG -3'

Sequencing Primer
(F):5'- GGAAAGAGCCTCTGTATCCTAATGC -3'
(R):5'- AGAATTCCTGTTGCCCTGTTACAG -3'
Posted On2018-07-23