Incidental Mutation 'R6660:Spns1'
ID526807
Institutional Source Beutler Lab
Gene Symbol Spns1
Ensembl Gene ENSMUSG00000030741
Gene Namespinster homolog 1
Synonyms2210013K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126370060-126377450 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 126375065 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032994] [ENSMUST00000119754] [ENSMUST00000119846] [ENSMUST00000138141] [ENSMUST00000150476] [ENSMUST00000205366] [ENSMUST00000205930]
Predicted Effect probably null
Transcript: ENSMUST00000032994
SMART Domains Protein: ENSMUSP00000032994
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:Sugar_tr 60 250 4.6e-15 PFAM
Pfam:OATP 60 385 1.5e-9 PFAM
Pfam:MFS_1 65 435 1.8e-34 PFAM
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119754
SMART Domains Protein: ENSMUSP00000112555
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.2e-8 PFAM
Pfam:Sugar_tr 60 250 1.3e-14 PFAM
Pfam:MFS_1 65 430 2.4e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119846
SMART Domains Protein: ENSMUSP00000112954
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.4e-8 PFAM
Pfam:Sugar_tr 60 250 1.5e-14 PFAM
Pfam:MFS_1 65 433 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137263
Predicted Effect probably benign
Transcript: ENSMUST00000138141
SMART Domains Protein: ENSMUSP00000117803
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 151 1.4e-9 PFAM
Pfam:MFS_1 65 149 1.5e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150476
SMART Domains Protein: ENSMUSP00000115152
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
Pfam:OATP 28 120 1.3e-8 PFAM
Pfam:Sugar_tr 28 220 1.6e-15 PFAM
Pfam:MFS_1 35 237 2.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152000
Predicted Effect probably benign
Transcript: ENSMUST00000205366
Predicted Effect probably null
Transcript: ENSMUST00000205930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206377
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Spns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Spns1 APN 7 126371242 unclassified probably null
IGL02353:Spns1 APN 7 126375140 missense probably damaging 1.00
IGL02561:Spns1 APN 7 126373769 critical splice donor site probably null
IGL03403:Spns1 APN 7 126371536 splice site probably null
R1634:Spns1 UTSW 7 126371171 unclassified probably benign
R2327:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R3552:Spns1 UTSW 7 126370371 missense possibly damaging 0.94
R3916:Spns1 UTSW 7 126371539 critical splice donor site probably null
R4025:Spns1 UTSW 7 126376946 nonsense probably null
R4095:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R4656:Spns1 UTSW 7 126374302 unclassified probably benign
R4657:Spns1 UTSW 7 126374302 unclassified probably benign
R4697:Spns1 UTSW 7 126377037 missense probably damaging 1.00
R4758:Spns1 UTSW 7 126370794 missense probably damaging 1.00
R5062:Spns1 UTSW 7 126374329 unclassified probably benign
R5371:Spns1 UTSW 7 126373764 unclassified probably benign
R5700:Spns1 UTSW 7 126372469 missense possibly damaging 0.95
R5973:Spns1 UTSW 7 126370323 missense probably damaging 1.00
R5985:Spns1 UTSW 7 126376730 missense probably benign 0.37
R7175:Spns1 UTSW 7 126373789 missense probably damaging 0.98
R8051:Spns1 UTSW 7 126372536 missense probably benign 0.37
Z1177:Spns1 UTSW 7 126372410 critical splice donor site probably null
Z1177:Spns1 UTSW 7 126372411 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGCACAGAGATCAGAGGG -3'
(R):5'- GCAAATCGCTGGTTAGGCAG -3'

Sequencing Primer
(F):5'- AGGAAAACCCGTGTGCC -3'
(R):5'- TTGCTGAGGGACCTGGAC -3'
Posted On2018-07-23