Incidental Mutation 'R6660:Ddx60'
List |< first << previous [record 7 of 33] next >> last >|
ID526808
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61956239 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 436 (H436Q)
Ref Sequence ENSEMBL: ENSMUSP00000122841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: H436Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: H436Q

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: H436Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: H436Q

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154398
AA Change: H436Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: H436Q

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 unclassified probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTTCTAGGCATGAGTCAGTGGTAC -3'
(R):5'- GAGAATCTGAGTGTCTTTCATCCAC -3'

Sequencing Primer
(F):5'- CTGAGTAATTTTAATTTGGTCCAGGC -3'
(R):5'- CACAAAGAAAATCTTCAGTTGCTAG -3'
Posted On2018-07-23