Incidental Mutation 'R6660:Atg5'
ID526809
Institutional Source Beutler Lab
Gene Symbol Atg5
Ensembl Gene ENSMUSG00000038160
Gene Nameautophagy related 5
SynonymsPaddy, 3110067M24Rik, Apg5l, 2010107M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location44268358-44364291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44294655 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 99 (N99S)
Ref Sequence ENSEMBL: ENSMUSP00000044769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039286]
Predicted Effect probably benign
Transcript: ENSMUST00000039286
AA Change: N99S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044769
Gene: ENSMUSG00000038160
AA Change: N99S

DomainStartEndE-ValueType
Pfam:APG5 79 270 2.6e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217412
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Two transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene results in impaired autophagy due to absence of autolysosomes. Homozygotes die within 1 day of birth, have shorter survival times and reduced amino acid levels under fasting conditions. Homozygotes for a gene trap insertion mutationin this gene show no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Atg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Atg5 APN 10 44363044 missense probably benign 0.00
P0041:Atg5 UTSW 10 44289942 missense probably benign 0.20
R2094:Atg5 UTSW 10 44319548 missense probably damaging 1.00
R4906:Atg5 UTSW 10 44363050 makesense probably null
R5718:Atg5 UTSW 10 44362987 missense probably benign 0.01
R6194:Atg5 UTSW 10 44294616 missense probably damaging 1.00
R7070:Atg5 UTSW 10 44286154 missense probably damaging 1.00
R7677:Atg5 UTSW 10 44347039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAGCCTGTGACAGTGCG -3'
(R):5'- TCAGAAGTGACAGACTATCCAGG -3'

Sequencing Primer
(F):5'- CCTGTGACAGTGCGTGGTAAG -3'
(R):5'- GATCACTTTGAGTCTGAGGCTAACC -3'
Posted On2018-07-23