Incidental Mutation 'R6660:Actg1'
ID526813
Institutional Source Beutler Lab
Gene Symbol Actg1
Ensembl Gene ENSMUSG00000062825
Gene Nameactin, gamma, cytoplasmic 1
SynonymsActl, E51
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6660 (G1)
Quality Score212.009
Status Not validated
Chromosome11
Chromosomal Location120345690-120348542 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120346755 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 289 (I289N)
Ref Sequence ENSEMBL: ENSMUSP00000101822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062147] [ENSMUST00000071555] [ENSMUST00000089616] [ENSMUST00000106215] [ENSMUST00000128055] [ENSMUST00000131103]
Predicted Effect probably damaging
Transcript: ENSMUST00000062147
AA Change: I67N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101821
Gene: ENSMUSG00000062825
AA Change: I67N

DomainStartEndE-ValueType
ACTIN 5 153 1.43e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071555
AA Change: I289N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071486
Gene: ENSMUSG00000062825
AA Change: I289N

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089616
AA Change: I44N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087043
Gene: ENSMUSG00000062825
AA Change: I44N

DomainStartEndE-ValueType
Pfam:Actin 1 84 3.8e-32 PFAM
Pfam:Actin 78 105 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106215
AA Change: I289N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101822
Gene: ENSMUSG00000062825
AA Change: I289N

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128055
SMART Domains Protein: ENSMUSP00000134296
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
ACTIN 62 268 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131103
SMART Domains Protein: ENSMUSP00000134070
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
Pfam:Actin 2 124 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183615
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Actins are highly conserved proteins that are involved in various types of cell motility and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta, and gamma, have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice in which this gene has been conditionally disrupted in muscle tissue display a reduced mobility and classical hind limb contractures when suspended by the tail. Mice homozygous for a null allele exhibit prenatal lethality, premature death, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Actg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0731:Actg1 UTSW 11 120346949 missense probably damaging 1.00
R2015:Actg1 UTSW 11 120346810 missense possibly damaging 0.95
R2860:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2861:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2862:Actg1 UTSW 11 120346801 missense probably benign 0.03
R4473:Actg1 UTSW 11 120348259 missense probably benign 0.01
R4732:Actg1 UTSW 11 120347479 splice site probably benign
R5004:Actg1 UTSW 11 120348160 intron probably benign
R5026:Actg1 UTSW 11 120346958 missense probably damaging 1.00
R5060:Actg1 UTSW 11 120347013 missense probably benign 0.10
R5216:Actg1 UTSW 11 120347754 missense probably damaging 0.98
R6328:Actg1 UTSW 11 120347760 missense possibly damaging 0.90
R6888:Actg1 UTSW 11 120347315 missense probably damaging 1.00
Z1177:Actg1 UTSW 11 120348109 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGACTGAGTACTTGCGCTC -3'
(R):5'- GTGATCACCATTGGCAATGAGC -3'

Sequencing Primer
(F):5'- CTCAGGGGGAGCAATGATCTGTG -3'
(R):5'- CAATGAGCGGTTCCGGTGTC -3'
Posted On2018-07-23