Incidental Mutation 'R6660:Vmn1r189'
ID526815
Institutional Source Beutler Lab
Gene Symbol Vmn1r189
Ensembl Gene ENSMUSG00000099611
Gene Namevomeronasal 1 receptor 189
SynonymsV1rh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location22099762-22105824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22101896 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 257 (L257H)
Ref Sequence ENSEMBL: ENSMUSP00000154722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186062] [ENSMUST00000227357] [ENSMUST00000228428]
Predicted Effect possibly damaging
Transcript: ENSMUST00000186062
AA Change: L257H

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140924
Gene: ENSMUSG00000099611
AA Change: L257H

DomainStartEndE-ValueType
Pfam:7tm_1 30 283 1e-7 PFAM
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227357
AA Change: L257H

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228428
AA Change: L257H

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Vmn1r189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03084:Vmn1r189 APN 13 22101838 nonsense probably null
R0437:Vmn1r189 UTSW 13 22102061 missense probably damaging 0.99
R1199:Vmn1r189 UTSW 13 22102658 missense probably damaging 0.99
R1795:Vmn1r189 UTSW 13 22102154 missense probably benign 0.03
R2251:Vmn1r189 UTSW 13 22102548 missense probably damaging 1.00
R3751:Vmn1r189 UTSW 13 22102212 missense probably benign 0.00
R3824:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3825:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3856:Vmn1r189 UTSW 13 22102269 missense possibly damaging 0.56
R4688:Vmn1r189 UTSW 13 22102119 missense probably damaging 0.99
R5665:Vmn1r189 UTSW 13 22102166 missense probably damaging 1.00
R5778:Vmn1r189 UTSW 13 22102382 missense probably damaging 0.99
R6149:Vmn1r189 UTSW 13 22101884 missense probably benign 0.33
R6431:Vmn1r189 UTSW 13 22102355 missense probably damaging 0.98
R6974:Vmn1r189 UTSW 13 22102458 missense probably damaging 1.00
R7051:Vmn1r189 UTSW 13 22102115 missense possibly damaging 0.58
R7269:Vmn1r189 UTSW 13 22102567 missense probably benign 0.00
R7330:Vmn1r189 UTSW 13 22102541 missense possibly damaging 0.95
R7611:Vmn1r189 UTSW 13 22102152 missense probably benign 0.02
R7894:Vmn1r189 UTSW 13 22101736 nonsense probably null
R7977:Vmn1r189 UTSW 13 22101736 nonsense probably null
Z1177:Vmn1r189 UTSW 13 22101883 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACATGCTTAAACTGCTTTGTG -3'
(R):5'- AGTGGCTACATGGTATTTCTTCTCC -3'

Sequencing Primer
(F):5'- TGAAGAACTGAGATTTCTTTGACAG -3'
(R):5'- GCTACATGGTATTTCTTCTCCACAAG -3'
Posted On2018-07-23