Incidental Mutation 'R6660:Pmm2'
ID 526817
Institutional Source Beutler Lab
Gene Symbol Pmm2
Ensembl Gene ENSMUSG00000022711
Gene Name phosphomannomutase 2
Synonyms
MMRRC Submission 044780-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6660 (G1)
Quality Score 140.008
Status Not validated
Chromosome 16
Chromosomal Location 8455467-8475472 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8473506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 240 (L240P)
Ref Sequence ENSEMBL: ENSMUSP00000155554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008537] [ENSMUST00000023396] [ENSMUST00000230828]
AlphaFold Q9Z2M7
Predicted Effect probably benign
Transcript: ENSMUST00000008537
SMART Domains Protein: ENSMUSP00000008537
Gene: ENSMUSG00000008393

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
CSP 65 130 1.12e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000023396
AA Change: L240P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023396
Gene: ENSMUSG00000022711
AA Change: L240P

DomainStartEndE-ValueType
Pfam:Hydrolase_3 5 229 1.6e-11 PFAM
Pfam:PMM 24 242 6.7e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134975
Predicted Effect probably damaging
Transcript: ENSMUST00000230828
AA Change: L240P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the isomerization of mannose 6-phosphate to mannose 1-phosphate, which is a precursor to GDP-mannose necessary for the synthesis of dolichol-P-oligosaccharides. Mutations in this gene have been shown to cause defects in glycoprotein biosynthesis, which manifests as carbohydrate-deficient glycoprotein syndrome type I. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality around E2.5. Transmission of the maternal null allele is severely impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,237,581 (GRCm39) I289N probably damaging Het
Atg5 A G 10: 44,170,651 (GRCm39) N99S probably benign Het
Ccdc88a A G 11: 29,432,663 (GRCm39) Q1223R probably benign Het
Cdc42 T C 4: 137,056,145 (GRCm39) D122G probably benign Het
Cpxm1 A G 2: 130,238,069 (GRCm39) S127P probably damaging Het
Cyfip2 A G 11: 46,140,634 (GRCm39) C730R possibly damaging Het
Ddx60 T A 8: 62,409,273 (GRCm39) H436Q probably benign Het
Dnah17 T C 11: 117,991,014 (GRCm39) Y1236C probably benign Het
Ep400 G A 5: 110,867,313 (GRCm39) R1000* probably null Het
Ergic3 A G 2: 155,859,754 (GRCm39) I227V probably damaging Het
Fam227b G T 2: 125,986,227 (GRCm39) P13Q probably damaging Het
Gal A G 19: 3,460,108 (GRCm39) L121P possibly damaging Het
Garin2 T C 12: 78,762,131 (GRCm39) V265A possibly damaging Het
Ifi207 T C 1: 173,556,972 (GRCm39) T589A probably benign Het
Intu T C 3: 40,586,100 (GRCm39) V27A probably benign Het
Lama1 A T 17: 68,111,495 (GRCm39) I2249L probably benign Het
Pdc T C 1: 150,209,086 (GRCm39) Y190H probably damaging Het
Polr1a T C 6: 71,944,358 (GRCm39) V1275A probably damaging Het
Rgsl1 T A 1: 153,701,512 (GRCm39) N314I possibly damaging Het
Rpe65 A T 3: 159,320,345 (GRCm39) N301Y probably damaging Het
Ryr1 A G 7: 28,737,770 (GRCm39) probably null Het
Sh3bp4 A G 1: 89,080,888 (GRCm39) S902G possibly damaging Het
Slc44a4 A T 17: 35,149,201 (GRCm39) R705W probably damaging Het
Slc4a10 A G 2: 62,080,747 (GRCm39) I325V possibly damaging Het
Spns1 A G 7: 125,974,237 (GRCm39) probably null Het
Syt6 T G 3: 103,532,960 (GRCm39) L363R probably damaging Het
Ttn A G 2: 76,544,759 (GRCm39) V32781A probably benign Het
Ube2l6 A G 2: 84,636,852 (GRCm39) T99A probably damaging Het
Unc13b A T 4: 43,177,412 (GRCm39) probably benign Het
Vmn1r189 A T 13: 22,286,066 (GRCm39) L257H possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zfpm2 T C 15: 40,518,981 (GRCm39) probably null Het
Other mutations in Pmm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Pmm2 APN 16 8,466,532 (GRCm39) missense probably damaging 1.00
IGL02184:Pmm2 APN 16 8,455,668 (GRCm39) missense possibly damaging 0.88
IGL02502:Pmm2 APN 16 8,463,227 (GRCm39) splice site probably benign
R0970:Pmm2 UTSW 16 8,460,640 (GRCm39) missense probably damaging 1.00
R7056:Pmm2 UTSW 16 8,460,628 (GRCm39) missense probably damaging 1.00
R7694:Pmm2 UTSW 16 8,463,254 (GRCm39) missense probably damaging 1.00
R7857:Pmm2 UTSW 16 8,460,632 (GRCm39) missense probably benign 0.02
R9714:Pmm2 UTSW 16 8,473,506 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCTCTAAGATGGGAGCG -3'
(R):5'- TTCTGTCTCTGAGGTCCCTGAG -3'

Sequencing Primer
(F):5'- CTCTCTAAGATGGGAGCGTCAGG -3'
(R):5'- AGACATGGTCTCATTCTGCCTCAG -3'
Posted On 2018-07-23