Incidental Mutation 'R6660:Vmn2r111'
ID 526818
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R6660 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22547941-22573273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22559051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Gal A G 19: 3,410,108 L121P possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22548030 missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22571841 missense probably benign
R9374:Vmn2r111 UTSW 17 22568878 missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22559151 missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGATGCAGCCCAATTTCTAC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- TGAGTAACTTAGGACAGAGAT -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2018-07-23