Incidental Mutation 'R6660:Gal'
ID526821
Institutional Source Beutler Lab
Gene Symbol Gal
Ensembl Gene ENSMUSG00000024907
Gene Namegalanin
SynonymsGaln
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6660 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3409919-3414472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3410108 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 121 (L121P)
Ref Sequence ENSEMBL: ENSMUSP00000025842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000025842] [ENSMUST00000127142] [ENSMUST00000142193]
Predicted Effect probably benign
Transcript: ENSMUST00000025840
SMART Domains Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Blast:CXC 246 287 4e-13 BLAST
CXC 332 373 1.37e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000025842
AA Change: L121P

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025842
Gene: ENSMUSG00000024907
AA Change: L121P

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Galanin 20 124 3.41e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127142
SMART Domains Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142193
SMART Domains Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a neuroendocrine peptide that is principally produced by a subpopulation of lactotrophs in the pituitary gland. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Mice lacking the encoded protein fail to lactate sufficiently due to abnormalities in the expression of prolactin and lactotroph proliferation, exhibit attenuated chronic neuropathic pain and developmental deficits in the dorsal root ganglion neurons. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in neuroendocrine homeostasis, prolactin release, lactotroph number, mammary gland maturation, lactation, susceptibility to neuronal excitotoxicity and induced seizures, sensory neuron developmentand regeneration, and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg1 A T 11: 120,346,755 I289N probably damaging Het
Atg5 A G 10: 44,294,655 N99S probably benign Het
Ccdc88a A G 11: 29,482,663 Q1223R probably benign Het
Cdc42 T C 4: 137,328,834 D122G probably benign Het
Cpxm1 A G 2: 130,396,149 S127P probably damaging Het
Cyfip2 A G 11: 46,249,807 C730R possibly damaging Het
Ddx60 T A 8: 61,956,239 H436Q probably benign Het
Dnah17 T C 11: 118,100,188 Y1236C probably benign Het
Ep400 G A 5: 110,719,447 R1000* probably null Het
Ergic3 A G 2: 156,017,834 I227V probably damaging Het
Fam227b G T 2: 126,144,307 P13Q probably damaging Het
Fam71d T C 12: 78,715,357 V265A possibly damaging Het
Ifi207 T C 1: 173,729,406 T589A probably benign Het
Intu T C 3: 40,531,951 V27A probably benign Het
Lama1 A T 17: 67,804,500 I2249L probably benign Het
Pdc T C 1: 150,333,335 Y190H probably damaging Het
Pmm2 T C 16: 8,655,642 L240P probably damaging Het
Polr1a T C 6: 71,967,374 V1275A probably damaging Het
Rgsl1 T A 1: 153,825,766 N314I possibly damaging Het
Rpe65 A T 3: 159,614,708 N301Y probably damaging Het
Ryr1 A G 7: 29,038,345 probably null Het
Sh3bp4 A G 1: 89,153,166 S902G possibly damaging Het
Slc44a4 A T 17: 34,930,225 R705W probably damaging Het
Slc4a10 A G 2: 62,250,403 I325V possibly damaging Het
Spns1 A G 7: 126,375,065 probably null Het
Syt6 T G 3: 103,625,644 L363R probably damaging Het
Ttn A G 2: 76,714,415 V32781A probably benign Het
Ube2l6 A G 2: 84,806,508 T99A probably damaging Het
Unc13b A T 4: 43,177,412 probably benign Het
Vmn1r189 A T 13: 22,101,896 L257H possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfpm2 T C 15: 40,655,585 probably null Het
Other mutations in Gal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Gal APN 19 3411575 missense probably benign 0.02
R0385:Gal UTSW 19 3411171 missense probably benign 0.13
R3605:Gal UTSW 19 3414026 splice site probably null
R4817:Gal UTSW 19 3411126 splice site probably null
R4911:Gal UTSW 19 3411590 missense probably benign 0.15
R5046:Gal UTSW 19 3411167 missense probably damaging 0.99
R5921:Gal UTSW 19 3410100 missense probably damaging 0.99
R7658:Gal UTSW 19 3413309 missense probably damaging 1.00
X0065:Gal UTSW 19 3411181 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TACGCTGCAGCATAGAAGAACC -3'
(R):5'- ACAGTCCTTCAGATGCTGTC -3'

Sequencing Primer
(F):5'- AACAGTCCCAGATACTTGCTAG -3'
(R):5'- TTCAGATGCTGTCCCCAAATCAGG -3'
Posted On2018-07-23