Mutagenetix > Incidental Mutation

Incidental Mutation 'R6661:Gatb'

526833

Institutional Source

Beutler Lab

Gene Symbol

Gatb

Ensembl Gene

ENSMUSG00000028085

Gene Name

glutamyl-tRNA(Gln) amidotransferase, subunit B

Synonyms

Pet112, Pet112l, 9430026F02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R6661 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85574119-85655622 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 85652419 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107674] [ENSMUST00000127348] [ENSMUST00000154148]

AlphaFold

Q99JT1

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000029726

Predicted Effect

probably benign
Transcript: ENSMUST00000107674
AA Change: T517A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000103301
Gene: ENSMUSG00000028085
AA Change: T517A

Domain	Start	End	E-Value	Type
Pfam:GatB_N	64	354	6.7e-105	PFAM
GatB_Yqey	406	518	2.09e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000127348

SMART Domains

Protein: ENSMUSP00000119949
Gene: ENSMUSG00000028085

Domain	Start	End	E-Value	Type
Pfam:GatB_N	65	353	8.3e-101	PFAM
GatB_Yqey	406	555	4.13e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154148

SMART Domains

Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

Domain	Start	End	E-Value	Type
Arfaptin	1	227	7.15e-121	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.8%

Validation Efficiency

93% (38/41)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,723,464	H741Q	possibly damaging	Het
Amy2a1	T	C	3: 113,531,714	Y77C	probably damaging	Het
Ankrd9	C	A	12: 110,977,768		probably benign	Het
Arhgap28	C	A	17: 67,845,751	W675L	probably damaging	Het
Arhgap44	A	G	11: 65,010,008	S595P	probably damaging	Het
Cacna1d	C	A	14: 30,089,875	D1273Y	probably damaging	Het
Ccr4	T	C	9: 114,495,963		probably benign	Het
Celsr1	A	G	15: 85,918,934	V2468A	probably damaging	Het
Chd2	T	C	7: 73,490,482	E666G	possibly damaging	Het
Ctnnd1	C	A	2: 84,609,642	V775L	probably damaging	Het
Cux2	C	A	5: 121,869,297	R767L	probably benign	Het
Decr2	A	G	17: 26,083,587	L217S	possibly damaging	Het
Dennd4c	T	A	4: 86,799,389	M541K	possibly damaging	Het
Dnah7a	T	C	1: 53,623,450	R651G	probably benign	Het
Fbrsl1	A	T	5: 110,378,097	F80I	probably damaging	Het
Fmnl2	C	A	2: 53,108,285	P554Q	probably damaging	Het
Gapvd1	C	T	2: 34,728,438	D308N	probably damaging	Het
Jcad	G	A	18: 4,675,256	G1006D	probably damaging	Het
Krt2	A	G	15: 101,815,963	Y289H	probably damaging	Het
Lrrc52	A	G	1: 167,466,353	F121S	probably damaging	Het
Lrrc63	G	A	14: 75,125,193	T299I	unknown	Het
Magi1	T	C	6: 93,943,308	N109S	probably benign	Het
Mbd4	C	A	6: 115,849,155	E271*	probably null	Het
Meis2	T	A	2: 115,864,270	D457V	probably damaging	Het
Mroh8	A	G	2: 157,225,627	V604A	probably benign	Het
Nedd4	T	A	9: 72,686,095	V150E	probably damaging	Het
Nes	A	G	3: 87,976,936	E790G	probably damaging	Het
Olfr1098	T	C	2: 86,923,148	N128S	probably benign	Het
Pik3c2a	T	C	7: 116,368,758	I834V	possibly damaging	Het
Plxnb1	T	C	9: 109,104,299	C666R	possibly damaging	Het
Prg2	T	C	2: 84,983,276		probably null	Het
Selenbp2	A	G	3: 94,702,514	D257G	probably damaging	Het
Slf1	T	C	13: 77,043,845	R957G	probably damaging	Het
Smim10l1	T	A	6: 133,105,550	M46K	possibly damaging	Het
Sptbn5	T	C	2: 120,072,375	Y50C	possibly damaging	Het
Tcea1	A	G	1: 4,858,429		probably benign	Het
Tex14	A	G	11: 87,495,016	E234G	probably damaging	Het
Tmbim4	T	C	10: 120,224,651	V181A	probably benign	Het
Trappc9	A	G	15: 72,590,144	S1091P	possibly damaging	Het
Txnrd3	T	A	6: 89,654,152	C143*	probably null	Het
Ushbp1	C	T	8: 71,390,661	C314Y	unknown	Het

Other mutations in Gatb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Gatb	APN	3	85601920	missense	possibly damaging	0.95
IGL00963:Gatb	APN	3	85618948	missense	probably benign	0.00
IGL01363:Gatb	APN	3	85652345	missense	probably damaging	1.00
IGL01650:Gatb	APN	3	85613484	missense	possibly damaging	0.68
IGL01973:Gatb	APN	3	85611424	missense	probably damaging	1.00
IGL02195:Gatb	APN	3	85604448	missense	probably benign	0.00
IGL02670:Gatb	APN	3	85613551	splice site	probably null
IGL02992:Gatb	APN	3	85618916	missense	probably damaging	1.00
IGL03025:Gatb	APN	3	85575874	missense	probably damaging	0.99
IGL03035:Gatb	APN	3	85601947	missense	probably damaging	1.00
IGL03090:Gatb	APN	3	85619023	intron	probably benign
R1313:Gatb	UTSW	3	85653826	missense	probably benign	0.01
R1851:Gatb	UTSW	3	85618877	missense	probably damaging	0.99
R1852:Gatb	UTSW	3	85618877	missense	probably damaging	0.99
R2134:Gatb	UTSW	3	85611370	missense	probably damaging	1.00
R2209:Gatb	UTSW	3	85653805	missense	probably benign	0.03
R5189:Gatb	UTSW	3	85636931	missense	probably benign	0.00
R5218:Gatb	UTSW	3	85604444	missense	probably benign
R5857:Gatb	UTSW	3	85575932	missense	probably damaging	1.00
R5871:Gatb	UTSW	3	85653776	nonsense	probably null
R6031:Gatb	UTSW	3	85613511	missense	possibly damaging	0.82
R6031:Gatb	UTSW	3	85613511	missense	possibly damaging	0.82
R6430:Gatb	UTSW	3	85637038	missense	probably benign	0.01
R7184:Gatb	UTSW	3	85636951	nonsense	probably null
R7210:Gatb	UTSW	3	85574220	missense	probably benign
R7501:Gatb	UTSW	3	85636990	missense	probably damaging	0.99
R7919:Gatb	UTSW	3	85604521	missense	probably damaging	1.00
R8335:Gatb	UTSW	3	85574321	critical splice donor site	probably null
R8536:Gatb	UTSW	3	85604561	missense	probably damaging	0.99
R8867:Gatb	UTSW	3	85604409	missense	probably damaging	1.00
R9312:Gatb	UTSW	3	85653763	missense	probably damaging	1.00
R9330:Gatb	UTSW	3	85652494	missense	probably benign	0.03
X0013:Gatb	UTSW	3	85601861	missense	probably damaging	1.00
Z1177:Gatb	UTSW	3	85636973	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCATCAGGTCTTCACACTCC -3'
(R):5'- GAGCTTGGATACTTGGCTGC -3'

Sequencing Primer
(F):5'- ATCAGGTCTTCACACTCCTCTCTC -3'
(R):5'- AGGCACTAGTGAAGTACTGTCCTC -3'

Posted On

2018-07-23