Incidental Mutation 'R6661:Gatb'
ID526833
Institutional Source Beutler Lab
Gene Symbol Gatb
Ensembl Gene ENSMUSG00000028085
Gene Nameglutamyl-tRNA(Gln) amidotransferase, subunit B
SynonymsPet112, Pet112l, 9430026F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6661 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location85574119-85655622 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 85652419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107674] [ENSMUST00000127348] [ENSMUST00000154148]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000029726
Predicted Effect probably benign
Transcript: ENSMUST00000107674
AA Change: T517A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103301
Gene: ENSMUSG00000028085
AA Change: T517A

DomainStartEndE-ValueType
Pfam:GatB_N 64 354 6.7e-105 PFAM
GatB_Yqey 406 518 2.09e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127348
SMART Domains Protein: ENSMUSP00000119949
Gene: ENSMUSG00000028085

DomainStartEndE-ValueType
Pfam:GatB_N 65 353 8.3e-101 PFAM
GatB_Yqey 406 555 4.13e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency 93% (38/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,464 H741Q possibly damaging Het
Amy2a1 T C 3: 113,531,714 Y77C probably damaging Het
Ankrd9 C A 12: 110,977,768 probably benign Het
Arhgap28 C A 17: 67,845,751 W675L probably damaging Het
Arhgap44 A G 11: 65,010,008 S595P probably damaging Het
Cacna1d C A 14: 30,089,875 D1273Y probably damaging Het
Ccr4 T C 9: 114,495,963 probably benign Het
Celsr1 A G 15: 85,918,934 V2468A probably damaging Het
Chd2 T C 7: 73,490,482 E666G possibly damaging Het
Ctnnd1 C A 2: 84,609,642 V775L probably damaging Het
Cux2 C A 5: 121,869,297 R767L probably benign Het
Decr2 A G 17: 26,083,587 L217S possibly damaging Het
Dennd4c T A 4: 86,799,389 M541K possibly damaging Het
Dnah7a T C 1: 53,623,450 R651G probably benign Het
Fbrsl1 A T 5: 110,378,097 F80I probably damaging Het
Fmnl2 C A 2: 53,108,285 P554Q probably damaging Het
Gapvd1 C T 2: 34,728,438 D308N probably damaging Het
Jcad G A 18: 4,675,256 G1006D probably damaging Het
Krt2 A G 15: 101,815,963 Y289H probably damaging Het
Lrrc52 A G 1: 167,466,353 F121S probably damaging Het
Lrrc63 G A 14: 75,125,193 T299I unknown Het
Magi1 T C 6: 93,943,308 N109S probably benign Het
Mbd4 C A 6: 115,849,155 E271* probably null Het
Meis2 T A 2: 115,864,270 D457V probably damaging Het
Mroh8 A G 2: 157,225,627 V604A probably benign Het
Nedd4 T A 9: 72,686,095 V150E probably damaging Het
Nes A G 3: 87,976,936 E790G probably damaging Het
Olfr1098 T C 2: 86,923,148 N128S probably benign Het
Pik3c2a T C 7: 116,368,758 I834V possibly damaging Het
Plxnb1 T C 9: 109,104,299 C666R possibly damaging Het
Prg2 T C 2: 84,983,276 probably null Het
Selenbp2 A G 3: 94,702,514 D257G probably damaging Het
Slf1 T C 13: 77,043,845 R957G probably damaging Het
Smim10l1 T A 6: 133,105,550 M46K possibly damaging Het
Sptbn5 T C 2: 120,072,375 Y50C possibly damaging Het
Tcea1 A G 1: 4,858,429 probably benign Het
Tex14 A G 11: 87,495,016 E234G probably damaging Het
Tmbim4 T C 10: 120,224,651 V181A probably benign Het
Trappc9 A G 15: 72,590,144 S1091P possibly damaging Het
Txnrd3 T A 6: 89,654,152 C143* probably null Het
Ushbp1 C T 8: 71,390,661 C314Y unknown Het
Other mutations in Gatb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gatb APN 3 85601920 missense possibly damaging 0.95
IGL00963:Gatb APN 3 85618948 missense probably benign 0.00
IGL01363:Gatb APN 3 85652345 missense probably damaging 1.00
IGL01650:Gatb APN 3 85613484 missense possibly damaging 0.68
IGL01973:Gatb APN 3 85611424 missense probably damaging 1.00
IGL02195:Gatb APN 3 85604448 missense probably benign 0.00
IGL02670:Gatb APN 3 85613551 splice site probably null
IGL02992:Gatb APN 3 85618916 missense probably damaging 1.00
IGL03025:Gatb APN 3 85575874 missense probably damaging 0.99
IGL03035:Gatb APN 3 85601947 missense probably damaging 1.00
IGL03090:Gatb APN 3 85619023 intron probably benign
R1313:Gatb UTSW 3 85653826 missense probably benign 0.01
R1851:Gatb UTSW 3 85618877 missense probably damaging 0.99
R1852:Gatb UTSW 3 85618877 missense probably damaging 0.99
R2134:Gatb UTSW 3 85611370 missense probably damaging 1.00
R2209:Gatb UTSW 3 85653805 missense probably benign 0.03
R5189:Gatb UTSW 3 85636931 missense probably benign 0.00
R5218:Gatb UTSW 3 85604444 missense probably benign
R5857:Gatb UTSW 3 85575932 missense probably damaging 1.00
R5871:Gatb UTSW 3 85653776 nonsense probably null
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6031:Gatb UTSW 3 85613511 missense possibly damaging 0.82
R6430:Gatb UTSW 3 85637038 missense probably benign 0.01
R7184:Gatb UTSW 3 85636951 nonsense probably null
R7210:Gatb UTSW 3 85574220 missense probably benign
R7501:Gatb UTSW 3 85636990 missense probably damaging 0.99
R7919:Gatb UTSW 3 85604521 missense probably damaging 1.00
R8335:Gatb UTSW 3 85574321 critical splice donor site probably null
X0013:Gatb UTSW 3 85601861 missense probably damaging 1.00
Z1177:Gatb UTSW 3 85636973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATCAGGTCTTCACACTCC -3'
(R):5'- GAGCTTGGATACTTGGCTGC -3'

Sequencing Primer
(F):5'- ATCAGGTCTTCACACTCCTCTCTC -3'
(R):5'- AGGCACTAGTGAAGTACTGTCCTC -3'
Posted On2018-07-23