Incidental Mutation 'R6661:Selenbp2'
ID526835
Institutional Source Beutler Lab
Gene Symbol Selenbp2
Ensembl Gene ENSMUSG00000068877
Gene Nameselenium binding protein 2
SynonymsAP56, Lpsb2, acetaminophen-binding protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R6661 (G1)
Quality Score221.009
Status Validated
Chromosome3
Chromosomal Location94693556-94704413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94702514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 257 (D257G)
Ref Sequence ENSEMBL: ENSMUSP00000134270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090848] [ENSMUST00000131650] [ENSMUST00000173849] [ENSMUST00000173981] [ENSMUST00000174223]
Predicted Effect probably damaging
Transcript: ENSMUST00000090848
AA Change: D319G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088358
Gene: ENSMUSG00000068877
AA Change: D319G

DomainStartEndE-ValueType
Pfam:SBP56 6 472 7.8e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132162
Predicted Effect probably damaging
Transcript: ENSMUST00000173849
AA Change: D257G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134270
Gene: ENSMUSG00000068877
AA Change: D257G

DomainStartEndE-ValueType
Pfam:SBP56 6 62 4.4e-22 PFAM
Pfam:SBP56 57 410 4.1e-165 PFAM
Pfam:Lactonase 163 296 4.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173981
SMART Domains Protein: ENSMUSP00000133320
Gene: ENSMUSG00000068877

DomainStartEndE-ValueType
Pfam:SBP56 1 128 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174223
SMART Domains Protein: ENSMUSP00000134623
Gene: ENSMUSG00000068877

DomainStartEndE-ValueType
Pfam:SBP56 6 134 3.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174377
Meta Mutation Damage Score 0.9569 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency 93% (38/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,464 H741Q possibly damaging Het
Amy2a1 T C 3: 113,531,714 Y77C probably damaging Het
Ankrd9 C A 12: 110,977,768 probably benign Het
Arhgap28 C A 17: 67,845,751 W675L probably damaging Het
Arhgap44 A G 11: 65,010,008 S595P probably damaging Het
Cacna1d C A 14: 30,089,875 D1273Y probably damaging Het
Ccr4 T C 9: 114,495,963 probably benign Het
Celsr1 A G 15: 85,918,934 V2468A probably damaging Het
Chd2 T C 7: 73,490,482 E666G possibly damaging Het
Ctnnd1 C A 2: 84,609,642 V775L probably damaging Het
Cux2 C A 5: 121,869,297 R767L probably benign Het
Decr2 A G 17: 26,083,587 L217S possibly damaging Het
Dennd4c T A 4: 86,799,389 M541K possibly damaging Het
Dnah7a T C 1: 53,623,450 R651G probably benign Het
Fbrsl1 A T 5: 110,378,097 F80I probably damaging Het
Fmnl2 C A 2: 53,108,285 P554Q probably damaging Het
Gapvd1 C T 2: 34,728,438 D308N probably damaging Het
Gatb A G 3: 85,652,419 probably null Het
Jcad G A 18: 4,675,256 G1006D probably damaging Het
Krt2 A G 15: 101,815,963 Y289H probably damaging Het
Lrrc52 A G 1: 167,466,353 F121S probably damaging Het
Lrrc63 G A 14: 75,125,193 T299I unknown Het
Magi1 T C 6: 93,943,308 N109S probably benign Het
Mbd4 C A 6: 115,849,155 E271* probably null Het
Meis2 T A 2: 115,864,270 D457V probably damaging Het
Mroh8 A G 2: 157,225,627 V604A probably benign Het
Nedd4 T A 9: 72,686,095 V150E probably damaging Het
Nes A G 3: 87,976,936 E790G probably damaging Het
Olfr1098 T C 2: 86,923,148 N128S probably benign Het
Pik3c2a T C 7: 116,368,758 I834V possibly damaging Het
Plxnb1 T C 9: 109,104,299 C666R possibly damaging Het
Prg2 T C 2: 84,983,276 probably null Het
Slf1 T C 13: 77,043,845 R957G probably damaging Het
Smim10l1 T A 6: 133,105,550 M46K possibly damaging Het
Sptbn5 T C 2: 120,072,375 Y50C possibly damaging Het
Tcea1 A G 1: 4,858,429 probably benign Het
Tex14 A G 11: 87,495,016 E234G probably damaging Het
Tmbim4 T C 10: 120,224,651 V181A probably benign Het
Trappc9 A G 15: 72,590,144 S1091P possibly damaging Het
Txnrd3 T A 6: 89,654,152 C143* probably null Het
Ushbp1 C T 8: 71,390,661 C314Y unknown Het
Other mutations in Selenbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Selenbp2 APN 3 94698144 missense possibly damaging 0.76
IGL02007:Selenbp2 APN 3 94698154 missense possibly damaging 0.67
IGL02103:Selenbp2 APN 3 94698131 missense probably null
IGL02222:Selenbp2 APN 3 94699962 missense probably damaging 1.00
IGL02441:Selenbp2 APN 3 94704064 missense probably benign 0.02
IGL03086:Selenbp2 APN 3 94699638 missense probably damaging 1.00
R0068:Selenbp2 UTSW 3 94703509 missense probably benign 0.00
R0256:Selenbp2 UTSW 3 94699701 missense probably benign 0.35
R0725:Selenbp2 UTSW 3 94697502 splice site probably benign
R0879:Selenbp2 UTSW 3 94699556 missense possibly damaging 0.76
R1636:Selenbp2 UTSW 3 94696815 missense probably damaging 1.00
R3719:Selenbp2 UTSW 3 94699617 missense probably damaging 1.00
R4828:Selenbp2 UTSW 3 94704119 missense probably benign 0.27
R4962:Selenbp2 UTSW 3 94703549 missense probably damaging 0.99
R7201:Selenbp2 UTSW 3 94702357 missense probably benign 0.03
R7221:Selenbp2 UTSW 3 94703826 nonsense probably null
R7413:Selenbp2 UTSW 3 94700097 missense probably benign 0.03
X0050:Selenbp2 UTSW 3 94704128 missense probably damaging 0.99
Z1176:Selenbp2 UTSW 3 94698100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCAGTGGAGAAGGTGATCC -3'
(R):5'- TCTTGTCAGACACAGTCCCTG -3'

Sequencing Primer
(F):5'- AGAAGGTGATCCAAGTGCCCTC -3'
(R):5'- ACAGTCCCTGTGTTCAGTCATGG -3'
Posted On2018-07-23