Mutagenetix > Incidental Mutation

Incidental Mutation 'R6661:Pik3c2a'

526845

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

044781-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6661 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115936500-116042684 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115967993 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 834 (I834V)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170430
AA Change: I834V

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: I834V

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206219
AA Change: I834V

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000206385

Meta Mutation Damage Score

0.2141

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.8%

Validation Efficiency

93% (38/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amy2a1	T	C	3: 113,325,363 (GRCm39)	Y77C	probably damaging	Het
Ankrd9	C	A	12: 110,944,202 (GRCm39)		probably benign	Het
Arhgap28	C	A	17: 68,152,746 (GRCm39)	W675L	probably damaging	Het
Arhgap44	A	G	11: 64,900,834 (GRCm39)	S595P	probably damaging	Het
Brd10	A	T	19: 29,700,864 (GRCm39)	H741Q	possibly damaging	Het
Cacna1d	C	A	14: 29,811,832 (GRCm39)	D1273Y	probably damaging	Het
Ccr4	T	C	9: 114,325,031 (GRCm39)		probably benign	Het
Celsr1	A	G	15: 85,803,135 (GRCm39)	V2468A	probably damaging	Het
Chd2	T	C	7: 73,140,230 (GRCm39)	E666G	possibly damaging	Het
Ctnnd1	C	A	2: 84,439,986 (GRCm39)	V775L	probably damaging	Het
Cux2	C	A	5: 122,007,360 (GRCm39)	R767L	probably benign	Het
Decr2	A	G	17: 26,302,561 (GRCm39)	L217S	possibly damaging	Het
Dennd4c	T	A	4: 86,717,626 (GRCm39)	M541K	possibly damaging	Het
Dnah7a	T	C	1: 53,662,609 (GRCm39)	R651G	probably benign	Het
Fbrsl1	A	T	5: 110,525,963 (GRCm39)	F80I	probably damaging	Het
Fmnl2	C	A	2: 52,998,297 (GRCm39)	P554Q	probably damaging	Het
Gapvd1	C	T	2: 34,618,450 (GRCm39)	D308N	probably damaging	Het
Gatb	A	G	3: 85,559,726 (GRCm39)		probably null	Het
Jcad	G	A	18: 4,675,256 (GRCm39)	G1006D	probably damaging	Het
Krt1c	A	G	15: 101,724,398 (GRCm39)	Y289H	probably damaging	Het
Lrrc52	A	G	1: 167,293,922 (GRCm39)	F121S	probably damaging	Het
Lrrc63	G	A	14: 75,362,633 (GRCm39)	T299I	unknown	Het
Magi1	T	C	6: 93,920,289 (GRCm39)	N109S	probably benign	Het
Mbd4	C	A	6: 115,826,116 (GRCm39)	E271*	probably null	Het
Meis2	T	A	2: 115,694,751 (GRCm39)	D457V	probably damaging	Het
Mroh8	A	G	2: 157,067,547 (GRCm39)	V604A	probably benign	Het
Nedd4	T	A	9: 72,593,377 (GRCm39)	V150E	probably damaging	Het
Nes	A	G	3: 87,884,243 (GRCm39)	E790G	probably damaging	Het
Or8h8	T	C	2: 86,753,492 (GRCm39)	N128S	probably benign	Het
Plxnb1	T	C	9: 108,933,367 (GRCm39)	C666R	possibly damaging	Het
Prg2	T	C	2: 84,813,620 (GRCm39)		probably null	Het
Selenbp2	A	G	3: 94,609,821 (GRCm39)	D257G	probably damaging	Het
Slf1	T	C	13: 77,191,964 (GRCm39)	R957G	probably damaging	Het
Smim10l1	T	A	6: 133,082,513 (GRCm39)	M46K	possibly damaging	Het
Sptbn5	T	C	2: 119,902,856 (GRCm39)	Y50C	possibly damaging	Het
Tcea1	A	G	1: 4,928,652 (GRCm39)		probably benign	Het
Tex14	A	G	11: 87,385,842 (GRCm39)	E234G	probably damaging	Het
Tmbim4	T	C	10: 120,060,556 (GRCm39)	V181A	probably benign	Het
Trappc9	A	G	15: 72,461,993 (GRCm39)	S1091P	possibly damaging	Het
Txnrd3	T	A	6: 89,631,134 (GRCm39)	C143*	probably null	Het
Ushbp1	C	T	8: 71,843,305 (GRCm39)	C314Y	unknown	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	115,963,735 (GRCm39)	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	115,973,038 (GRCm39)	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116,017,429 (GRCm39)	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	115,975,485 (GRCm39)	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	115,950,000 (GRCm39)	intron	probably benign
IGL01695:Pik3c2a	APN	7	116,016,753 (GRCm39)	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	115,945,423 (GRCm39)	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	115,950,039 (GRCm39)	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	115,987,299 (GRCm39)	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	115,962,575 (GRCm39)	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116,005,126 (GRCm39)	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	115,972,049 (GRCm39)	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	115,963,748 (GRCm39)	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116,017,256 (GRCm39)	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116,017,074 (GRCm39)	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	115,953,307 (GRCm39)	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	115,972,979 (GRCm39)	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	115,953,290 (GRCm39)	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	115,945,482 (GRCm39)	splice site	probably benign
R0991:Pik3c2a	UTSW	7	115,961,280 (GRCm39)	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	115,950,160 (GRCm39)	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116,016,908 (GRCm39)	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	115,987,300 (GRCm39)	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	115,987,280 (GRCm39)	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	115,968,083 (GRCm39)	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116,017,162 (GRCm39)	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116,017,755 (GRCm39)	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	115,945,471 (GRCm39)	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116,016,899 (GRCm39)	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	115,975,747 (GRCm39)	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	115,967,352 (GRCm39)	missense	probably benign
R1875:Pik3c2a	UTSW	7	116,017,206 (GRCm39)	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	115,953,241 (GRCm39)	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	115,941,472 (GRCm39)	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	115,963,738 (GRCm39)	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	115,950,057 (GRCm39)	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116,016,686 (GRCm39)	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	115,972,126 (GRCm39)	nonsense	probably null
R3814:Pik3c2a	UTSW	7	115,947,414 (GRCm39)	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	115,963,785 (GRCm39)	nonsense	probably null
R4386:Pik3c2a	UTSW	7	115,953,334 (GRCm39)	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	115,957,923 (GRCm39)	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116,017,060 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	115,947,509 (GRCm39)	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	115,941,636 (GRCm39)	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	115,950,021 (GRCm39)	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116,016,893 (GRCm39)	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116,005,186 (GRCm39)	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	115,967,419 (GRCm39)	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	115,961,799 (GRCm39)	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	115,947,440 (GRCm39)	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116,016,731 (GRCm39)	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	115,939,460 (GRCm39)	critical splice acceptor site	probably null
R6789:Pik3c2a	UTSW	7	115,961,419 (GRCm39)	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	115,993,540 (GRCm39)	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116,017,223 (GRCm39)	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116,017,368 (GRCm39)	nonsense	probably null
R7153:Pik3c2a	UTSW	7	115,941,487 (GRCm39)	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	115,987,331 (GRCm39)	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	115,987,321 (GRCm39)	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116,005,178 (GRCm39)	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	115,973,074 (GRCm39)	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	115,975,621 (GRCm39)	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	115,953,242 (GRCm39)	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	115,972,089 (GRCm39)	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	115,993,474 (GRCm39)	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	115,939,331 (GRCm39)	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	115,987,312 (GRCm39)	nonsense	probably null
R7737:Pik3c2a	UTSW	7	115,955,488 (GRCm39)	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	115,993,529 (GRCm39)	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116,016,693 (GRCm39)	missense	probably benign
R7922:Pik3c2a	UTSW	7	115,990,517 (GRCm39)	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	115,949,350 (GRCm39)	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116,017,271 (GRCm39)	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	115,942,232 (GRCm39)	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116,017,283 (GRCm39)	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116,017,584 (GRCm39)	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	115,975,464 (GRCm39)	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	115,951,112 (GRCm39)	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116,017,659 (GRCm39)	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	115,987,320 (GRCm39)	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	115,993,531 (GRCm39)	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116,017,004 (GRCm39)	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116,017,115 (GRCm39)	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	115,945,413 (GRCm39)	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	115,990,558 (GRCm39)	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	115,961,289 (GRCm39)	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	115,939,321 (GRCm39)	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	115,957,939 (GRCm39)	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	115,945,427 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATGTTTTACTCTCAGAGAAACTG -3'
(R):5'- TGAATTCTTGATCTTAGCCGTTCTG -3'

Sequencing Primer
(F):5'- TTACTCTCAGAGAAACTGGAAATGG -3'
(R):5'- ATCTTAGCCGTTCTGACTGG -3'

Posted On

2018-07-23