Incidental Mutation 'R6661:Nedd4'
ID526846
Institutional Source Beutler Lab
Gene Symbol Nedd4
Ensembl Gene ENSMUSG00000032216
Gene Nameneural precursor cell expressed, developmentally down-regulated 4
SynonymsNedd4, Nedd4-1, Nedd4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6661 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location72662346-72749852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72686095 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 150 (V150E)
Ref Sequence ENSEMBL: ENSMUSP00000138983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034740] [ENSMUST00000183375] [ENSMUST00000184333] [ENSMUST00000184450]
Predicted Effect probably damaging
Transcript: ENSMUST00000034740
AA Change: V150E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: V150E

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
low complexity region 283 293 N/A INTRINSIC
WW 406 438 1.31e-12 SMART
WW 461 493 1.26e-14 SMART
HECTc 550 886 2.37e-194 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183375
SMART Domains Protein: ENSMUSP00000138852
Gene: ENSMUSG00000032216

DomainStartEndE-ValueType
C2 79 163 1.12e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184333
AA Change: V40E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139190
Gene: ENSMUSG00000032216
AA Change: V40E

DomainStartEndE-ValueType
C2 4 71 3.38e-4 SMART
WW 140 172 2.32e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184450
AA Change: V150E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138983
Gene: ENSMUSG00000032216
AA Change: V150E

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195338
Meta Mutation Damage Score 0.6306 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency 93% (38/41)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,464 H741Q possibly damaging Het
Amy2a1 T C 3: 113,531,714 Y77C probably damaging Het
Ankrd9 C A 12: 110,977,768 probably benign Het
Arhgap28 C A 17: 67,845,751 W675L probably damaging Het
Arhgap44 A G 11: 65,010,008 S595P probably damaging Het
Cacna1d C A 14: 30,089,875 D1273Y probably damaging Het
Ccr4 T C 9: 114,495,963 probably benign Het
Celsr1 A G 15: 85,918,934 V2468A probably damaging Het
Chd2 T C 7: 73,490,482 E666G possibly damaging Het
Ctnnd1 C A 2: 84,609,642 V775L probably damaging Het
Cux2 C A 5: 121,869,297 R767L probably benign Het
Decr2 A G 17: 26,083,587 L217S possibly damaging Het
Dennd4c T A 4: 86,799,389 M541K possibly damaging Het
Dnah7a T C 1: 53,623,450 R651G probably benign Het
Fbrsl1 A T 5: 110,378,097 F80I probably damaging Het
Fmnl2 C A 2: 53,108,285 P554Q probably damaging Het
Gapvd1 C T 2: 34,728,438 D308N probably damaging Het
Gatb A G 3: 85,652,419 probably null Het
Jcad G A 18: 4,675,256 G1006D probably damaging Het
Krt2 A G 15: 101,815,963 Y289H probably damaging Het
Lrrc52 A G 1: 167,466,353 F121S probably damaging Het
Lrrc63 G A 14: 75,125,193 T299I unknown Het
Magi1 T C 6: 93,943,308 N109S probably benign Het
Mbd4 C A 6: 115,849,155 E271* probably null Het
Meis2 T A 2: 115,864,270 D457V probably damaging Het
Mroh8 A G 2: 157,225,627 V604A probably benign Het
Nes A G 3: 87,976,936 E790G probably damaging Het
Olfr1098 T C 2: 86,923,148 N128S probably benign Het
Pik3c2a T C 7: 116,368,758 I834V possibly damaging Het
Plxnb1 T C 9: 109,104,299 C666R possibly damaging Het
Prg2 T C 2: 84,983,276 probably null Het
Selenbp2 A G 3: 94,702,514 D257G probably damaging Het
Slf1 T C 13: 77,043,845 R957G probably damaging Het
Smim10l1 T A 6: 133,105,550 M46K possibly damaging Het
Sptbn5 T C 2: 120,072,375 Y50C possibly damaging Het
Tcea1 A G 1: 4,858,429 probably benign Het
Tex14 A G 11: 87,495,016 E234G probably damaging Het
Tmbim4 T C 10: 120,224,651 V181A probably benign Het
Trappc9 A G 15: 72,590,144 S1091P possibly damaging Het
Txnrd3 T A 6: 89,654,152 C143* probably null Het
Ushbp1 C T 8: 71,390,661 C314Y unknown Het
Other mutations in Nedd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nedd4 APN 9 72735089 missense probably damaging 1.00
IGL00573:Nedd4 APN 9 72686056 splice site probably null
IGL01973:Nedd4 APN 9 72736934 missense possibly damaging 0.81
IGL02177:Nedd4 APN 9 72747157 missense probably damaging 1.00
IGL03082:Nedd4 APN 9 72677394 critical splice donor site probably null
Evaporation UTSW 9 72686095 missense probably damaging 1.00
reduction UTSW 9 72731271 missense possibly damaging 0.49
R0194:Nedd4 UTSW 9 72670053 missense possibly damaging 0.72
R0714:Nedd4 UTSW 9 72731446 splice site probably benign
R1331:Nedd4 UTSW 9 72677386 missense probably damaging 1.00
R1633:Nedd4 UTSW 9 72671257 missense possibly damaging 0.50
R1764:Nedd4 UTSW 9 72730907 missense probably damaging 0.99
R2192:Nedd4 UTSW 9 72742718 missense probably damaging 0.99
R2196:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2220:Nedd4 UTSW 9 72736707 missense probably damaging 1.00
R2850:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2994:Nedd4 UTSW 9 72730903 missense probably benign 0.04
R3040:Nedd4 UTSW 9 72669961 missense probably benign
R3697:Nedd4 UTSW 9 72740187 missense probably damaging 1.00
R3884:Nedd4 UTSW 9 72725077 missense probably benign 0.16
R4475:Nedd4 UTSW 9 72671239 nonsense probably null
R4476:Nedd4 UTSW 9 72671239 nonsense probably null
R4883:Nedd4 UTSW 9 72740233 splice site probably null
R5066:Nedd4 UTSW 9 72710519 missense probably damaging 1.00
R5947:Nedd4 UTSW 9 72730850 intron probably benign
R5974:Nedd4 UTSW 9 72743638 critical splice donor site probably null
R6247:Nedd4 UTSW 9 72726438 missense probably damaging 1.00
R6651:Nedd4 UTSW 9 72731271 missense possibly damaging 0.49
R7170:Nedd4 UTSW 9 72670099 missense probably benign 0.00
R7237:Nedd4 UTSW 9 72725064 missense probably benign 0.04
R7653:Nedd4 UTSW 9 72743628 missense probably damaging 1.00
R7772:Nedd4 UTSW 9 72677326 missense possibly damaging 0.77
R7905:Nedd4 UTSW 9 72677379 nonsense probably null
R8194:Nedd4 UTSW 9 72686107 missense probably damaging 1.00
R8229:Nedd4 UTSW 9 72731388 missense probably benign 0.00
Z1088:Nedd4 UTSW 9 72670078 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AAGTGTGACTGTGGGTAACG -3'
(R):5'- GTCCTTCAGAACAGAATGGAATG -3'

Sequencing Primer
(F):5'- ACGTGAGTCTTGCCTATTCTTTG -3'
(R):5'- ATGGAATGGGAGGGTTAACTC -3'
Posted On2018-07-23