Mutagenetix > Incidental Mutation

Incidental Mutation 'R6661:Trappc9'

526855

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6661 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72590144 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1091 (S1091P)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023276
AA Change: S912P

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: S912P

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089770
AA Change: S1091P

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: S1091P

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230426

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.8%

Validation Efficiency

93% (38/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,723,464	H741Q	possibly damaging	Het
Amy2a1	T	C	3: 113,531,714	Y77C	probably damaging	Het
Ankrd9	C	A	12: 110,977,768		probably benign	Het
Arhgap28	C	A	17: 67,845,751	W675L	probably damaging	Het
Arhgap44	A	G	11: 65,010,008	S595P	probably damaging	Het
Cacna1d	C	A	14: 30,089,875	D1273Y	probably damaging	Het
Ccr4	T	C	9: 114,495,963		probably benign	Het
Celsr1	A	G	15: 85,918,934	V2468A	probably damaging	Het
Chd2	T	C	7: 73,490,482	E666G	possibly damaging	Het
Ctnnd1	C	A	2: 84,609,642	V775L	probably damaging	Het
Cux2	C	A	5: 121,869,297	R767L	probably benign	Het
Decr2	A	G	17: 26,083,587	L217S	possibly damaging	Het
Dennd4c	T	A	4: 86,799,389	M541K	possibly damaging	Het
Dnah7a	T	C	1: 53,623,450	R651G	probably benign	Het
Fbrsl1	A	T	5: 110,378,097	F80I	probably damaging	Het
Fmnl2	C	A	2: 53,108,285	P554Q	probably damaging	Het
Gapvd1	C	T	2: 34,728,438	D308N	probably damaging	Het
Gatb	A	G	3: 85,652,419		probably null	Het
Jcad	G	A	18: 4,675,256	G1006D	probably damaging	Het
Krt2	A	G	15: 101,815,963	Y289H	probably damaging	Het
Lrrc52	A	G	1: 167,466,353	F121S	probably damaging	Het
Lrrc63	G	A	14: 75,125,193	T299I	unknown	Het
Magi1	T	C	6: 93,943,308	N109S	probably benign	Het
Mbd4	C	A	6: 115,849,155	E271*	probably null	Het
Meis2	T	A	2: 115,864,270	D457V	probably damaging	Het
Mroh8	A	G	2: 157,225,627	V604A	probably benign	Het
Nedd4	T	A	9: 72,686,095	V150E	probably damaging	Het
Nes	A	G	3: 87,976,936	E790G	probably damaging	Het
Olfr1098	T	C	2: 86,923,148	N128S	probably benign	Het
Pik3c2a	T	C	7: 116,368,758	I834V	possibly damaging	Het
Plxnb1	T	C	9: 109,104,299	C666R	possibly damaging	Het
Prg2	T	C	2: 84,983,276		probably null	Het
Selenbp2	A	G	3: 94,702,514	D257G	probably damaging	Het
Slf1	T	C	13: 77,043,845	R957G	probably damaging	Het
Smim10l1	T	A	6: 133,105,550	M46K	possibly damaging	Het
Sptbn5	T	C	2: 120,072,375	Y50C	possibly damaging	Het
Tcea1	A	G	1: 4,858,429		probably benign	Het
Tex14	A	G	11: 87,495,016	E234G	probably damaging	Het
Tmbim4	T	C	10: 120,224,651	V181A	probably benign	Het
Txnrd3	T	A	6: 89,654,152	C143*	probably null	Het
Ushbp1	C	T	8: 71,390,661	C314Y	unknown	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- TATGGAGGACATGGCCTTCG -3'
(R):5'- TAGTGGTGGCACCTTTCAAAG -3'

Sequencing Primer
(F):5'- ACATGGCCTTCGGGATGAG -3'
(R):5'- ATGGGTTCTCAGACATGCAGC -3'

Posted On

2018-07-23