Incidental Mutation 'R6663:Prg4'
ID 526861
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Name proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms MSF, SZP, lubricin, DOL54
MMRRC Submission 044783-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R6663 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 150325163-150341916 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to A at 150330852 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000159035] [ENSMUST00000161320] [ENSMUST00000161611] [ENSMUST00000164600] [ENSMUST00000162367]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006171
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111901
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111902
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159035
SMART Domains Protein: ENSMUSP00000124410
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161320
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161611
AA Change: T607I
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: T607I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000164600
AA Change: T607I
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: T607I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,411,923 (GRCm39) S1314P probably damaging Het
Btbd3 T A 2: 138,121,003 (GRCm39) I59K probably benign Het
Clcn2 A G 16: 20,521,995 (GRCm39) *865R probably null Het
Col22a1 T C 15: 71,691,908 (GRCm39) Q749R unknown Het
Cpsf2 T C 12: 101,965,852 (GRCm39) Y606H probably damaging Het
Csn1s1 T C 5: 87,823,599 (GRCm39) V154A probably benign Het
Cux1 T A 5: 136,514,701 (GRCm39) E23V probably damaging Het
Cyp2j9 C A 4: 96,467,679 (GRCm39) W269L probably benign Het
Dbf4 T C 5: 8,453,184 (GRCm39) M273V probably benign Het
Dnhd1 A G 7: 105,334,899 (GRCm39) probably null Het
Fezf1 A G 6: 23,247,527 (GRCm39) S183P probably damaging Het
Irx2 A G 13: 72,777,248 (GRCm39) Y23C probably damaging Het
Itga1 A T 13: 115,110,641 (GRCm39) N983K probably benign Het
Kifc1 A G 17: 34,100,430 (GRCm39) probably benign Het
Lrrc14b T C 13: 74,509,480 (GRCm39) N309S probably damaging Het
Lyst A T 13: 13,838,701 (GRCm39) probably null Het
Map1b T C 13: 99,566,530 (GRCm39) T2064A unknown Het
Mark3 T A 12: 111,541,517 (GRCm39) N11K probably benign Het
Med6 T A 12: 81,628,649 (GRCm39) D80V possibly damaging Het
Mfhas1 A G 8: 36,056,272 (GRCm39) E249G probably damaging Het
Mroh2b A G 15: 4,977,417 (GRCm39) I1256M probably benign Het
Nkx2-9 G T 12: 56,658,723 (GRCm39) R164S probably benign Het
Or4p20 T A 2: 88,253,694 (GRCm39) N225I probably benign Het
Phf10 T C 17: 15,179,774 (GRCm39) D33G probably null Het
Plekha5 A G 6: 140,523,016 (GRCm39) M719V probably damaging Het
Pln A G 10: 53,219,792 (GRCm39) probably benign Het
Slc35b3 A G 13: 39,138,112 (GRCm39) L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,652,778 (GRCm39) probably null Het
Ube2j1 C T 4: 33,045,198 (GRCm39) S157L probably damaging Het
Zfp462 A G 4: 55,008,933 (GRCm39) T300A possibly damaging Het
Zfp668 G A 7: 127,466,941 (GRCm39) R212C probably damaging Het
Zup1 A G 10: 33,825,431 (GRCm39) M17T possibly damaging Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150,327,671 (GRCm39) missense probably damaging 0.99
IGL02033:Prg4 APN 1 150,331,619 (GRCm39) intron probably benign
IGL02154:Prg4 APN 1 150,330,613 (GRCm39) intron probably benign
IGL03111:Prg4 APN 1 150,327,653 (GRCm39) missense probably benign 0.06
IGL03177:Prg4 APN 1 150,331,354 (GRCm39) intron probably benign
IGL03260:Prg4 APN 1 150,331,378 (GRCm39) intron probably benign
IGL03281:Prg4 APN 1 150,325,839 (GRCm39) splice site probably benign
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
R0233:Prg4 UTSW 1 150,329,298 (GRCm39) splice site probably benign
R0255:Prg4 UTSW 1 150,331,558 (GRCm39) intron probably benign
R0616:Prg4 UTSW 1 150,336,462 (GRCm39) missense probably damaging 1.00
R1016:Prg4 UTSW 1 150,330,442 (GRCm39) intron probably benign
R1826:Prg4 UTSW 1 150,327,760 (GRCm39) missense probably benign 0.09
R1862:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1863:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1922:Prg4 UTSW 1 150,325,750 (GRCm39) nonsense probably null
R1940:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R3765:Prg4 UTSW 1 150,327,122 (GRCm39) missense probably damaging 0.97
R3855:Prg4 UTSW 1 150,327,751 (GRCm39) missense probably damaging 1.00
R3894:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3895:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3912:Prg4 UTSW 1 150,327,619 (GRCm39) missense probably damaging 1.00
R3935:Prg4 UTSW 1 150,333,908 (GRCm39) missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R4475:Prg4 UTSW 1 150,330,610 (GRCm39) intron probably benign
R4794:Prg4 UTSW 1 150,330,297 (GRCm39) intron probably benign
R4910:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4911:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4993:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R5378:Prg4 UTSW 1 150,330,977 (GRCm39) intron probably benign
R5381:Prg4 UTSW 1 150,330,204 (GRCm39) intron probably benign
R5452:Prg4 UTSW 1 150,331,519 (GRCm39) intron probably benign
R5870:Prg4 UTSW 1 150,331,300 (GRCm39) nonsense probably null
R5888:Prg4 UTSW 1 150,328,101 (GRCm39) missense probably damaging 1.00
R5929:Prg4 UTSW 1 150,329,880 (GRCm39) missense probably benign 0.01
R6058:Prg4 UTSW 1 150,327,197 (GRCm39) missense probably damaging 0.99
R6059:Prg4 UTSW 1 150,325,748 (GRCm39) missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150,331,567 (GRCm39) intron probably benign
R6272:Prg4 UTSW 1 150,330,517 (GRCm39) intron probably benign
R6459:Prg4 UTSW 1 150,330,052 (GRCm39) intron probably benign
R6659:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R6882:Prg4 UTSW 1 150,329,246 (GRCm39) missense probably damaging 1.00
R6970:Prg4 UTSW 1 150,331,657 (GRCm39) intron probably benign
R7078:Prg4 UTSW 1 150,334,014 (GRCm39) missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150,328,005 (GRCm39) missense probably damaging 1.00
R7264:Prg4 UTSW 1 150,329,818 (GRCm39) missense not run
R7487:Prg4 UTSW 1 150,331,656 (GRCm39) missense unknown
R7531:Prg4 UTSW 1 150,330,786 (GRCm39) missense unknown
R7651:Prg4 UTSW 1 150,330,696 (GRCm39) missense unknown
R7701:Prg4 UTSW 1 150,333,293 (GRCm39) missense possibly damaging 0.53
R8072:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R8168:Prg4 UTSW 1 150,331,601 (GRCm39) missense unknown
R8248:Prg4 UTSW 1 150,330,877 (GRCm39) missense unknown
R8436:Prg4 UTSW 1 150,331,318 (GRCm39) missense unknown
R8460:Prg4 UTSW 1 150,331,692 (GRCm39) missense possibly damaging 0.83
R8514:Prg4 UTSW 1 150,330,396 (GRCm39) missense unknown
R8904:Prg4 UTSW 1 150,331,810 (GRCm39) missense possibly damaging 0.83
R9072:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9073:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9274:Prg4 UTSW 1 150,331,924 (GRCm39) missense possibly damaging 0.53
R9337:Prg4 UTSW 1 150,327,116 (GRCm39) missense probably damaging 1.00
R9488:Prg4 UTSW 1 150,327,024 (GRCm39) missense probably benign
R9613:Prg4 UTSW 1 150,331,660 (GRCm39) missense unknown
R9670:Prg4 UTSW 1 150,326,618 (GRCm39) missense probably benign 0.01
X0024:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTTGTGGGTTCAGGCTCCT -3'
(R):5'- TCCCAAGGAGCCTGAACC -3'

Sequencing Primer
(F):5'- CTCCTTGGGAGTTGTGGGTTCAG -3'
(R):5'- TCCCAAGGAGCCTGAACC -3'
Posted On 2018-07-23