Incidental Mutation 'R6663:Olfr1181'
ID526862
Institutional Source Beutler Lab
Gene Symbol Olfr1181
Ensembl Gene ENSMUSG00000075125
Gene Nameolfactory receptor 1181
SynonymsMOR225-9P, GA_x6K02T2Q125-49911636-49910701
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88420321-88426171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88423350 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 225 (N225I)
Ref Sequence ENSEMBL: ENSMUSP00000150939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099823] [ENSMUST00000102619] [ENSMUST00000213190] [ENSMUST00000216121] [ENSMUST00000217320]
Predicted Effect probably benign
Transcript: ENSMUST00000099823
AA Change: N225I

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097411
Gene: ENSMUSG00000075125
AA Change: N225I

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 1.5e-48 PFAM
Pfam:7tm_1 39 285 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102619
AA Change: N225I

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099679
Gene: ENSMUSG00000075125
AA Change: N225I

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 285 7.2e-26 PFAM
Pfam:7tm_4 137 278 3.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213190
AA Change: N225I

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216121
Predicted Effect probably benign
Transcript: ENSMUST00000217320
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Olfr1181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Olfr1181 APN 2 88423786 missense probably benign 0.30
IGL02224:Olfr1181 APN 2 88423708 splice site probably null
IGL03293:Olfr1181 APN 2 88423227 missense probably damaging 1.00
IGL02802:Olfr1181 UTSW 2 88423488 missense probably benign 0.23
R2214:Olfr1181 UTSW 2 88423117 missense probably benign 0.00
R2508:Olfr1181 UTSW 2 88423456 missense possibly damaging 0.95
R4050:Olfr1181 UTSW 2 88423623 missense probably damaging 0.99
R5404:Olfr1181 UTSW 2 88423801 missense probably damaging 0.98
R5727:Olfr1181 UTSW 2 88423447 missense probably benign 0.00
R6578:Olfr1181 UTSW 2 88423144 missense probably benign 0.12
R6974:Olfr1181 UTSW 2 88423812 missense possibly damaging 0.93
R7042:Olfr1181 UTSW 2 88423402 missense possibly damaging 0.89
R7659:Olfr1181 UTSW 2 88423926 missense probably damaging 1.00
R8443:Olfr1181 UTSW 2 88423401 missense probably benign
X0018:Olfr1181 UTSW 2 88423662 missense probably benign
Z1177:Olfr1181 UTSW 2 88423815 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACCAAACCTTCTTTATGGCAC -3'
(R):5'- TGTGGACCCAATGAAATAGACC -3'

Sequencing Primer
(F):5'- TATATATGAGGGGGTTGAACATAGG -3'
(R):5'- TGAAATAGACCACTACTACTGTGACG -3'
Posted On2018-07-23