Incidental Mutation 'R6663:Btbd3'
ID526863
Institutional Source Beutler Lab
Gene Symbol Btbd3
Ensembl Gene ENSMUSG00000062098
Gene NameBTB (POZ) domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location138256565-138589292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138279083 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 59 (I59K)
Ref Sequence ENSEMBL: ENSMUSP00000074864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075410] [ENSMUST00000091556]
Predicted Effect probably benign
Transcript: ENSMUST00000075410
AA Change: I59K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074864
Gene: ENSMUSG00000062098
AA Change: I59K

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
low complexity region 63 69 N/A INTRINSIC
low complexity region 89 101 N/A INTRINSIC
BTB 128 228 5.55e-23 SMART
BACK 234 343 1.11e-12 SMART
Pfam:PHR 384 529 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091556
SMART Domains Protein: ENSMUSP00000089144
Gene: ENSMUSG00000062098

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
BTB 59 159 5.55e-23 SMART
BACK 165 274 1.11e-12 SMART
Pfam:PHR 315 461 8.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155646
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Btbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd3 APN 2 138279777 missense probably benign 0.05
IGL01650:Btbd3 APN 2 138284105 missense probably damaging 1.00
IGL01783:Btbd3 APN 2 138283736 missense probably damaging 1.00
IGL03108:Btbd3 APN 2 138284123 missense possibly damaging 0.55
IGL03232:Btbd3 APN 2 138284143 missense probably damaging 1.00
IGL03259:Btbd3 APN 2 138279760 missense probably damaging 1.00
IGL03405:Btbd3 APN 2 138279761 missense probably damaging 0.98
R0540:Btbd3 UTSW 2 138283816 missense possibly damaging 0.90
R0607:Btbd3 UTSW 2 138283816 missense possibly damaging 0.90
R1171:Btbd3 UTSW 2 138283961 missense probably benign 0.03
R1983:Btbd3 UTSW 2 138283688 missense probably damaging 0.99
R2034:Btbd3 UTSW 2 138278983 missense probably benign 0.15
R5111:Btbd3 UTSW 2 138278909 start codon destroyed probably null 0.53
R6170:Btbd3 UTSW 2 138278942 missense probably damaging 1.00
R6708:Btbd3 UTSW 2 138283571 missense possibly damaging 0.62
R7210:Btbd3 UTSW 2 138283744 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACATCCTGTACTCATGGTAG -3'
(R):5'- TAAACACGCTAGCCTGCCAG -3'

Sequencing Primer
(F):5'- TCCTGTACTCATGGTAGATGATAAAG -3'
(R):5'- AGCAAGGGCGCTTACCTTTC -3'
Posted On2018-07-23