Incidental Mutation 'R6663:Ube2j1'
ID526864
Institutional Source Beutler Lab
Gene Symbol Ube2j1
Ensembl Gene ENSMUSG00000028277
Gene Nameubiquitin-conjugating enzyme E2J 1
Synonyms1110030I22Rik, Ubc6p, Ncube, 0710008M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6663 (G1)
Quality Score127.008
Status Validated
Chromosome4
Chromosomal Location33031416-33052363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33045198 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 157 (S157L)
Ref Sequence ENSEMBL: ENSMUSP00000029944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029944] [ENSMUST00000124992]
Predicted Effect probably damaging
Transcript: ENSMUST00000029944
AA Change: S157L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029944
Gene: ENSMUSG00000028277
AA Change: S157L

DomainStartEndE-ValueType
PDB:2F4W|B 1 78 5e-17 PDB
Blast:UBCc 1 116 4e-72 BLAST
SCOP:d1c4zd_ 2 50 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124992
AA Change: S226L

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118333
Gene: ENSMUSG00000028277
AA Change: S226L

DomainStartEndE-ValueType
UBCc 13 160 4.49e-30 SMART
low complexity region 249 269 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135924
SMART Domains Protein: ENSMUSP00000115757
Gene: ENSMUSG00000028277

DomainStartEndE-ValueType
UBCc 1 144 8.08e-23 SMART
low complexity region 193 213 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum (ER) and may contribute to quality control ER-associated degradation by the ubiquitin-proteasome system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, decreased body size, and male infertility associated with defective spermiogenesis, teratozoospermia, and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Ube2j1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Ube2j1 APN 4 33043993 splice site probably benign
IGL01800:Ube2j1 APN 4 33045115 missense probably benign 0.00
IGL02707:Ube2j1 APN 4 33038206 missense possibly damaging 0.95
IGL03368:Ube2j1 APN 4 33038317 missense probably damaging 1.00
R0314:Ube2j1 UTSW 4 33043991 splice site probably benign
R1575:Ube2j1 UTSW 4 33045116 missense probably benign 0.23
R1714:Ube2j1 UTSW 4 33049886 missense probably damaging 1.00
R2044:Ube2j1 UTSW 4 33049696 missense probably benign 0.16
R2267:Ube2j1 UTSW 4 33049943 missense possibly damaging 0.51
R2850:Ube2j1 UTSW 4 33049696 missense probably benign 0.16
R3737:Ube2j1 UTSW 4 33036723 missense probably benign 0.06
R3738:Ube2j1 UTSW 4 33036723 missense probably benign 0.06
R4354:Ube2j1 UTSW 4 33049682 missense probably benign 0.05
R5527:Ube2j1 UTSW 4 33045164 missense probably benign 0.00
R5554:Ube2j1 UTSW 4 33040745 missense probably damaging 1.00
R8122:Ube2j1 UTSW 4 33045145 missense probably benign 0.00
X0024:Ube2j1 UTSW 4 33049928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGGGAGTTAGCTGATTGTTAAC -3'
(R):5'- GCAGCTGGGCTAAAATCCTAC -3'

Sequencing Primer
(F):5'- CACAGTTCTTATAACACTGCTCTTGG -3'
(R):5'- GCTGGGCTAAAATCCTACTACTAAG -3'
Posted On2018-07-23