Incidental Mutation 'R6663:Zfp462'
ID 526865
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Name zinc finger protein 462
Synonyms 9430078C22Rik, Zfpip, Gt4-2
MMRRC Submission 044783-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.881) question?
Stock # R6663 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 54945048-55083563 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55008933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 300 (T300A)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
AlphaFold B1AWL2
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098070
AA Change: T300A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: T300A

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,411,923 (GRCm39) S1314P probably damaging Het
Btbd3 T A 2: 138,121,003 (GRCm39) I59K probably benign Het
Clcn2 A G 16: 20,521,995 (GRCm39) *865R probably null Het
Col22a1 T C 15: 71,691,908 (GRCm39) Q749R unknown Het
Cpsf2 T C 12: 101,965,852 (GRCm39) Y606H probably damaging Het
Csn1s1 T C 5: 87,823,599 (GRCm39) V154A probably benign Het
Cux1 T A 5: 136,514,701 (GRCm39) E23V probably damaging Het
Cyp2j9 C A 4: 96,467,679 (GRCm39) W269L probably benign Het
Dbf4 T C 5: 8,453,184 (GRCm39) M273V probably benign Het
Dnhd1 A G 7: 105,334,899 (GRCm39) probably null Het
Fezf1 A G 6: 23,247,527 (GRCm39) S183P probably damaging Het
Irx2 A G 13: 72,777,248 (GRCm39) Y23C probably damaging Het
Itga1 A T 13: 115,110,641 (GRCm39) N983K probably benign Het
Kifc1 A G 17: 34,100,430 (GRCm39) probably benign Het
Lrrc14b T C 13: 74,509,480 (GRCm39) N309S probably damaging Het
Lyst A T 13: 13,838,701 (GRCm39) probably null Het
Map1b T C 13: 99,566,530 (GRCm39) T2064A unknown Het
Mark3 T A 12: 111,541,517 (GRCm39) N11K probably benign Het
Med6 T A 12: 81,628,649 (GRCm39) D80V possibly damaging Het
Mfhas1 A G 8: 36,056,272 (GRCm39) E249G probably damaging Het
Mroh2b A G 15: 4,977,417 (GRCm39) I1256M probably benign Het
Nkx2-9 G T 12: 56,658,723 (GRCm39) R164S probably benign Het
Or4p20 T A 2: 88,253,694 (GRCm39) N225I probably benign Het
Phf10 T C 17: 15,179,774 (GRCm39) D33G probably null Het
Plekha5 A G 6: 140,523,016 (GRCm39) M719V probably damaging Het
Pln A G 10: 53,219,792 (GRCm39) probably benign Het
Prg4 G A 1: 150,330,852 (GRCm39) probably benign Het
Slc35b3 A G 13: 39,138,112 (GRCm39) L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,652,778 (GRCm39) probably null Het
Ube2j1 C T 4: 33,045,198 (GRCm39) S157L probably damaging Het
Zfp668 G A 7: 127,466,941 (GRCm39) R212C probably damaging Het
Zup1 A G 10: 33,825,431 (GRCm39) M17T possibly damaging Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55,011,483 (GRCm39) splice site probably null
IGL00421:Zfp462 APN 4 55,023,576 (GRCm39) missense probably benign 0.00
IGL00899:Zfp462 APN 4 55,007,732 (GRCm39) missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55,013,181 (GRCm39) missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55,008,912 (GRCm39) missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55,008,586 (GRCm39) missense probably benign 0.20
IGL01862:Zfp462 APN 4 55,023,441 (GRCm39) missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55,010,613 (GRCm39) missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55,012,138 (GRCm39) missense probably benign 0.04
IGL02029:Zfp462 APN 4 55,079,395 (GRCm39) splice site probably benign
IGL02338:Zfp462 APN 4 55,010,292 (GRCm39) missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55,010,613 (GRCm39) missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55,012,986 (GRCm39) missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55,060,236 (GRCm39) missense probably null 1.00
IGL02815:Zfp462 APN 4 55,051,303 (GRCm39) missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55,080,785 (GRCm39) missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55,009,758 (GRCm39) unclassified probably benign
FR4304:Zfp462 UTSW 4 55,009,757 (GRCm39) unclassified probably benign
FR4737:Zfp462 UTSW 4 55,009,760 (GRCm39) unclassified probably benign
FR4737:Zfp462 UTSW 4 55,009,758 (GRCm39) unclassified probably benign
FR4976:Zfp462 UTSW 4 55,009,761 (GRCm39) unclassified probably benign
FR4976:Zfp462 UTSW 4 55,009,760 (GRCm39) unclassified probably benign
P0035:Zfp462 UTSW 4 55,009,086 (GRCm39) missense probably benign
R0052:Zfp462 UTSW 4 55,011,762 (GRCm39) missense probably benign 0.03
R0143:Zfp462 UTSW 4 55,023,402 (GRCm39) splice site probably benign
R0145:Zfp462 UTSW 4 55,010,529 (GRCm39) missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55,079,314 (GRCm39) missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55,008,768 (GRCm39) missense probably benign
R0359:Zfp462 UTSW 4 55,013,689 (GRCm39) missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55,010,534 (GRCm39) missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55,013,689 (GRCm39) missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55,011,951 (GRCm39) missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55,007,563 (GRCm39) start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55,013,000 (GRCm39) missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55,060,046 (GRCm39) missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55,007,667 (GRCm39) missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55,009,002 (GRCm39) missense probably benign
R1541:Zfp462 UTSW 4 55,008,928 (GRCm39) missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55,013,489 (GRCm39) missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55,010,010 (GRCm39) missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55,010,830 (GRCm39) missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55,008,496 (GRCm39) missense probably benign 0.00
R2148:Zfp462 UTSW 4 55,013,670 (GRCm39) missense probably benign 0.01
R2179:Zfp462 UTSW 4 55,009,524 (GRCm39) missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55,013,712 (GRCm39) missense probably benign
R2352:Zfp462 UTSW 4 55,008,313 (GRCm39) missense probably null
R2566:Zfp462 UTSW 4 55,008,522 (GRCm39) missense probably benign 0.00
R3879:Zfp462 UTSW 4 55,060,095 (GRCm39) missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55,012,402 (GRCm39) missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55,008,411 (GRCm39) missense probably benign 0.00
R4413:Zfp462 UTSW 4 55,012,672 (GRCm39) missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55,008,934 (GRCm39) missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55,008,934 (GRCm39) missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55,011,889 (GRCm39) missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55,012,981 (GRCm39) missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55,009,349 (GRCm39) missense probably benign
R4682:Zfp462 UTSW 4 55,011,376 (GRCm39) missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55,008,612 (GRCm39) missense probably benign
R4744:Zfp462 UTSW 4 55,011,598 (GRCm39) missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55,013,476 (GRCm39) missense probably benign 0.00
R4819:Zfp462 UTSW 4 55,060,044 (GRCm39) missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55,012,213 (GRCm39) missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55,010,668 (GRCm39) missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55,009,444 (GRCm39) missense probably benign 0.02
R4891:Zfp462 UTSW 4 55,060,055 (GRCm39) missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55,051,204 (GRCm39) missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55,010,667 (GRCm39) missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55,016,986 (GRCm39) splice site probably null
R5173:Zfp462 UTSW 4 55,011,115 (GRCm39) missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55,016,887 (GRCm39) missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55,012,299 (GRCm39) missense probably benign
R5314:Zfp462 UTSW 4 55,013,178 (GRCm39) missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55,060,077 (GRCm39) missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55,009,818 (GRCm39) missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55,050,281 (GRCm39) missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55,013,464 (GRCm39) missense probably benign 0.01
R5775:Zfp462 UTSW 4 55,010,590 (GRCm39) missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55,023,573 (GRCm39) missense probably benign 0.01
R6280:Zfp462 UTSW 4 55,010,253 (GRCm39) missense probably benign 0.00
R6325:Zfp462 UTSW 4 55,080,680 (GRCm39) missense probably benign 0.04
R6542:Zfp462 UTSW 4 55,023,433 (GRCm39) missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55,012,324 (GRCm39) splice site probably null
R6872:Zfp462 UTSW 4 55,012,326 (GRCm39) missense probably benign 0.01
R6889:Zfp462 UTSW 4 55,007,671 (GRCm39) missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55,009,544 (GRCm39) missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55,007,775 (GRCm39) missense probably benign 0.25
R6988:Zfp462 UTSW 4 55,080,716 (GRCm39) missense probably benign 0.00
R7131:Zfp462 UTSW 4 55,009,380 (GRCm39) missense probably benign
R7151:Zfp462 UTSW 4 55,051,271 (GRCm39) missense probably damaging 0.99
R7684:Zfp462 UTSW 4 55,008,908 (GRCm39) missense probably benign
R7741:Zfp462 UTSW 4 55,008,637 (GRCm39) missense probably benign 0.00
R7750:Zfp462 UTSW 4 55,016,958 (GRCm39) missense probably benign 0.06
R7812:Zfp462 UTSW 4 55,008,509 (GRCm39) missense probably benign 0.00
R7863:Zfp462 UTSW 4 55,007,747 (GRCm39) missense probably benign
R7898:Zfp462 UTSW 4 55,012,995 (GRCm39) missense probably damaging 0.98
R7993:Zfp462 UTSW 4 55,011,907 (GRCm39) missense probably damaging 1.00
R7995:Zfp462 UTSW 4 55,011,907 (GRCm39) missense probably damaging 1.00
R8023:Zfp462 UTSW 4 55,073,106 (GRCm39) critical splice donor site probably null
R8394:Zfp462 UTSW 4 55,011,862 (GRCm39) missense probably damaging 1.00
R8669:Zfp462 UTSW 4 55,051,313 (GRCm39) missense probably damaging 0.99
R8877:Zfp462 UTSW 4 55,011,097 (GRCm39) missense probably damaging 0.98
R8980:Zfp462 UTSW 4 55,009,681 (GRCm39) unclassified probably benign
R9023:Zfp462 UTSW 4 55,007,563 (GRCm39) start codon destroyed probably null 0.00
R9243:Zfp462 UTSW 4 55,009,595 (GRCm39) nonsense probably null
R9378:Zfp462 UTSW 4 55,011,510 (GRCm39) missense probably benign 0.00
R9417:Zfp462 UTSW 4 55,016,988 (GRCm39) missense probably benign 0.26
R9476:Zfp462 UTSW 4 55,080,735 (GRCm39) missense probably benign
R9510:Zfp462 UTSW 4 55,080,735 (GRCm39) missense probably benign
R9610:Zfp462 UTSW 4 55,009,545 (GRCm39) missense possibly damaging 0.73
R9628:Zfp462 UTSW 4 55,009,423 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTCGGGGCAACTTTTG -3'
(R):5'- CATGTCAGACATTCCGTAACG -3'

Sequencing Primer
(F):5'- GTTGTGAGTGGTGTAGCTACCAG -3'
(R):5'- TCTCCGTCAAGTTCACAAGG -3'
Posted On 2018-07-23