Incidental Mutation 'R6663:Cyp2j9'
ID526866
Institutional Source Beutler Lab
Gene Symbol Cyp2j9
Ensembl Gene ENSMUSG00000015224
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 9
Synonyms8430417E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location96568429-96591578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96579442 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 269 (W269L)
Ref Sequence ENSEMBL: ENSMUSP00000050464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055693]
Predicted Effect probably benign
Transcript: ENSMUST00000055693
AA Change: W269L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050464
Gene: ENSMUSG00000015224
AA Change: W269L

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 498 8.7e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126509
Meta Mutation Damage Score 0.2490 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Cyp2j9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Cyp2j9 APN 4 96585930 missense possibly damaging 0.94
IGL01287:Cyp2j9 APN 4 96583428 missense probably benign 0.03
R0032:Cyp2j9 UTSW 4 96568806 missense possibly damaging 0.72
R0032:Cyp2j9 UTSW 4 96568806 missense possibly damaging 0.72
R0384:Cyp2j9 UTSW 4 96585885 missense probably benign 0.06
R0525:Cyp2j9 UTSW 4 96579565 critical splice acceptor site probably null
R1430:Cyp2j9 UTSW 4 96583964 splice site probably benign
R1991:Cyp2j9 UTSW 4 96571964 missense probably damaging 1.00
R2103:Cyp2j9 UTSW 4 96571964 missense probably damaging 1.00
R2881:Cyp2j9 UTSW 4 96574012 missense probably damaging 1.00
R4760:Cyp2j9 UTSW 4 96568791 missense probably damaging 1.00
R4823:Cyp2j9 UTSW 4 96568735 missense possibly damaging 0.79
R5782:Cyp2j9 UTSW 4 96573905 missense probably benign 0.35
R5898:Cyp2j9 UTSW 4 96577714 missense probably benign 0.44
R6259:Cyp2j9 UTSW 4 96584006 missense probably benign 0.01
R6353:Cyp2j9 UTSW 4 96585898 missense probably benign 0.00
R7719:Cyp2j9 UTSW 4 96568842 missense probably benign 0.00
R7915:Cyp2j9 UTSW 4 96591384 start gained probably benign
RF020:Cyp2j9 UTSW 4 96577652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACGCAAAGCTTTCCTG -3'
(R):5'- AATGTGGCACCATGTGTCTC -3'

Sequencing Primer
(F):5'- CTGGCCAACAGGTATACAAGGGTC -3'
(R):5'- GGCACCATGTGTCTCCATAACTG -3'
Posted On2018-07-23