Incidental Mutation 'R6663:Dbf4'
ID526867
Institutional Source Beutler Lab
Gene Symbol Dbf4
Ensembl Gene ENSMUSG00000002297
Gene NameDBF4 zinc finger
SynonymsAsk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8396973-8422716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8403184 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 273 (M273V)
Ref Sequence ENSEMBL: ENSMUSP00000132985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002368] [ENSMUST00000168500] [ENSMUST00000171808]
Predicted Effect probably benign
Transcript: ENSMUST00000002368
AA Change: M272V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002368
Gene: ENSMUSG00000002297
AA Change: M272V

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 287 334 7.09e-28 SMART
low complexity region 643 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163141
AA Change: M3V
SMART Domains Protein: ENSMUSP00000129317
Gene: ENSMUSG00000002297
AA Change: M3V

DomainStartEndE-ValueType
ZnF_DBF 19 66 7.09e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166364
Predicted Effect probably benign
Transcript: ENSMUST00000168500
AA Change: M273V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132985
Gene: ENSMUSG00000002297
AA Change: M273V

DomainStartEndE-ValueType
Pfam:BRCT 41 179 2e-7 PFAM
low complexity region 182 204 N/A INTRINSIC
PDB:4F9C|B 210 308 2e-42 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168637
Predicted Effect probably benign
Transcript: ENSMUST00000171808
AA Change: M273V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132906
Gene: ENSMUSG00000002297
AA Change: M273V

DomainStartEndE-ValueType
Blast:BRCT 44 181 9e-85 BLAST
low complexity region 182 204 N/A INTRINSIC
ZnF_DBF 288 335 7.09e-28 SMART
low complexity region 644 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197442
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Dbf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Dbf4 APN 5 8408492 critical splice donor site probably null
IGL02086:Dbf4 APN 5 8403189 missense probably benign 0.09
IGL02582:Dbf4 APN 5 8403172 missense probably benign 0.32
IGL02711:Dbf4 APN 5 8408235 missense probably benign 0.08
PIT4362001:Dbf4 UTSW 5 8403664 missense probably benign 0.00
R1201:Dbf4 UTSW 5 8397498 missense possibly damaging 0.80
R1823:Dbf4 UTSW 5 8397539 missense probably benign 0.00
R1863:Dbf4 UTSW 5 8397375 nonsense probably null
R2237:Dbf4 UTSW 5 8408542 missense possibly damaging 0.51
R2276:Dbf4 UTSW 5 8421333 missense possibly damaging 0.91
R2279:Dbf4 UTSW 5 8421333 missense possibly damaging 0.91
R4774:Dbf4 UTSW 5 8403062 intron probably benign
R4839:Dbf4 UTSW 5 8408263 nonsense probably null
R4932:Dbf4 UTSW 5 8398039 missense probably benign
R6009:Dbf4 UTSW 5 8403718 missense probably damaging 0.99
R6141:Dbf4 UTSW 5 8408545 missense possibly damaging 0.92
R6236:Dbf4 UTSW 5 8398579 intron probably benign
R6583:Dbf4 UTSW 5 8398143 missense probably damaging 0.96
R7665:Dbf4 UTSW 5 8397867 missense probably damaging 0.99
R7864:Dbf4 UTSW 5 8410010 missense possibly damaging 0.86
R7898:Dbf4 UTSW 5 8408232 critical splice donor site probably null
R8192:Dbf4 UTSW 5 8398134 missense probably benign 0.00
RF013:Dbf4 UTSW 5 8397985 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGTTGCAAACTATACTCGGCATAG -3'
(R):5'- AAAACCCGTTTCTCTTGACCG -3'

Sequencing Primer
(F):5'- CTATACTCGGCATAGTAAAATGGGAC -3'
(R):5'- CTTGACCGTTTGAAATGTTCTTCAG -3'
Posted On2018-07-23