Incidental Mutation 'R6663:Csn1s1'
ID 526868
Institutional Source Beutler Lab
Gene Symbol Csn1s1
Ensembl Gene ENSMUSG00000070702
Gene Name casein alpha s1
Synonyms Csna
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6663 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 87666208-87682578 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87675740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 154 (V154A)
Ref Sequence ENSEMBL: ENSMUSP00000092225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094641] [ENSMUST00000197157] [ENSMUST00000197631] [ENSMUST00000199506]
AlphaFold P19228
Predicted Effect probably benign
Transcript: ENSMUST00000094641
AA Change: V154A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092225
Gene: ENSMUSG00000070702
AA Change: V154A

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 74 102 N/A INTRINSIC
internal_repeat_1 117 148 7.63e-5 PROSPERO
internal_repeat_1 141 172 7.63e-5 PROSPERO
low complexity region 173 198 N/A INTRINSIC
Pfam:Casein 215 304 5.7e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000197157
AA Change: Y129H
SMART Domains Protein: ENSMUSP00000142839
Gene: ENSMUSG00000070702
AA Change: Y129H

DomainStartEndE-ValueType
low complexity region 16 44 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197631
AA Change: V154A
SMART Domains Protein: ENSMUSP00000142794
Gene: ENSMUSG00000070702
AA Change: V154A

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 74 102 N/A INTRINSIC
internal_repeat_1 117 148 3.17e-5 PROSPERO
internal_repeat_1 141 172 3.17e-5 PROSPERO
low complexity region 173 198 N/A INTRINSIC
Pfam:Casein 215 282 4.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198432
Predicted Effect probably benign
Transcript: ENSMUST00000199506
SMART Domains Protein: ENSMUSP00000143694
Gene: ENSMUSG00000070702

DomainStartEndE-ValueType
low complexity region 19 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200344
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display reduced milk prodution and abnormal milk composition with reduced protein, calcium and phosphate concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Csn1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Csn1s1 APN 5 87667259 missense probably benign 0.03
IGL01984:Csn1s1 APN 5 87676510 unclassified probably benign
IGL02183:Csn1s1 APN 5 87677618 missense possibly damaging 0.52
IGL02335:Csn1s1 APN 5 87680845 missense probably benign 0.09
IGL02496:Csn1s1 APN 5 87677594 unclassified probably benign
IGL02502:Csn1s1 APN 5 87680925 missense probably benign 0.06
IGL02622:Csn1s1 APN 5 87677642 critical splice donor site probably null
IGL03403:Csn1s1 APN 5 87667293 missense probably benign 0.19
R0004:Csn1s1 UTSW 5 87671531 missense probably benign 0.01
R0472:Csn1s1 UTSW 5 87677627 missense possibly damaging 0.71
R1076:Csn1s1 UTSW 5 87676383 splice site probably null
R1364:Csn1s1 UTSW 5 87677584 unclassified probably benign
R1761:Csn1s1 UTSW 5 87679035 missense probably benign 0.32
R2056:Csn1s1 UTSW 5 87671528 missense possibly damaging 0.66
R2937:Csn1s1 UTSW 5 87677136 missense possibly damaging 0.52
R2938:Csn1s1 UTSW 5 87677136 missense possibly damaging 0.52
R3793:Csn1s1 UTSW 5 87680843 nonsense probably null
R4274:Csn1s1 UTSW 5 87680961 makesense probably null
R4568:Csn1s1 UTSW 5 87680904 missense possibly damaging 0.51
R4959:Csn1s1 UTSW 5 87673261 missense probably benign 0.27
R4973:Csn1s1 UTSW 5 87673261 missense probably benign 0.27
R5133:Csn1s1 UTSW 5 87680878 missense possibly damaging 0.92
R5611:Csn1s1 UTSW 5 87677644 splice site probably null
R6008:Csn1s1 UTSW 5 87678085 critical splice donor site probably null
R6940:Csn1s1 UTSW 5 87675023 missense possibly damaging 0.46
R7164:Csn1s1 UTSW 5 87674228 missense possibly damaging 0.53
R7990:Csn1s1 UTSW 5 87680053 missense possibly damaging 0.92
R7998:Csn1s1 UTSW 5 87674228 missense possibly damaging 0.53
R8729:Csn1s1 UTSW 5 87677139 critical splice donor site probably null
R8950:Csn1s1 UTSW 5 87676623 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCTTCCCTGGCTAAGG -3'
(R):5'- ATCCTCCTCTTAGCATATTGATTGG -3'

Sequencing Primer
(F):5'- TTCCCTGTTTCAGGTGAG -3'
(R):5'- CCTCTTAGCATATTGATTGGCATATG -3'
Posted On 2018-07-23