Incidental Mutation 'R6663:Fezf1'
ID526871
Institutional Source Beutler Lab
Gene Symbol Fezf1
Ensembl Gene ENSMUSG00000029697
Gene NameFez family zinc finger 1
SynonymsZfp312-like, 3110069A13Rik, Fez
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location23245044-23248362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23247528 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 183 (S183P)
Ref Sequence ENSEMBL: ENSMUSP00000031709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031709]
Predicted Effect probably damaging
Transcript: ENSMUST00000031709
AA Change: S183P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031709
Gene: ENSMUSG00000029697
AA Change: S183P

DomainStartEndE-ValueType
low complexity region 102 114 N/A INTRINSIC
ZnF_C2H2 260 282 1.58e-3 SMART
ZnF_C2H2 288 310 3.39e-3 SMART
ZnF_C2H2 316 338 1.38e-3 SMART
ZnF_C2H2 344 366 2.57e-3 SMART
ZnF_C2H2 372 394 2.53e-2 SMART
ZnF_C2H2 400 423 1.38e-3 SMART
low complexity region 441 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202489
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that belongs to the zinc finger double domain protein family. The encoded protein is thought to play a role in the embryonic migration of gonadotropin-releasing hormone neurons into the brain. Mutations in this gene are associated with hypogonadotropic hypogonadism-22 with anosmia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null mutation of this gene display neonatal lethality, impaired olfactory bulb development and impaired olfactory bulb interneuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Fezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fezf1 APN 6 23247843 missense possibly damaging 0.76
IGL02538:Fezf1 APN 6 23246558 missense probably damaging 1.00
IGL02983:Fezf1 APN 6 23247872 missense probably damaging 0.99
IGL03372:Fezf1 APN 6 23246910 missense probably damaging 1.00
R0494:Fezf1 UTSW 6 23246055 missense probably damaging 1.00
R0612:Fezf1 UTSW 6 23247029 missense probably damaging 1.00
R0836:Fezf1 UTSW 6 23246999 missense probably benign 0.01
R1930:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R1931:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R2103:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2104:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2233:Fezf1 UTSW 6 23246003 missense probably damaging 1.00
R3404:Fezf1 UTSW 6 23247284 missense probably benign 0.13
R3950:Fezf1 UTSW 6 23247420 nonsense probably null
R4209:Fezf1 UTSW 6 23246617 missense probably damaging 0.99
R4400:Fezf1 UTSW 6 23247710 missense probably benign 0.22
R4614:Fezf1 UTSW 6 23247858 missense possibly damaging 0.71
R5287:Fezf1 UTSW 6 23248011 missense probably benign
R5878:Fezf1 UTSW 6 23247581 missense possibly damaging 0.71
R5943:Fezf1 UTSW 6 23246949 nonsense probably null
R5952:Fezf1 UTSW 6 23247428 missense probably benign 0.08
R7158:Fezf1 UTSW 6 23245790 missense probably benign
R7184:Fezf1 UTSW 6 23247836 missense probably benign 0.31
X0025:Fezf1 UTSW 6 23247909 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGAAAACTTTGGGCTTGGC -3'
(R):5'- TGCGCGCTAAGTCTTAAGG -3'

Sequencing Primer
(F):5'- CTGAAATCCGAGGTTTTGAAAGC -3'
(R):5'- CGCTAAGTCTTAAGGGCGAC -3'
Posted On2018-07-23