Incidental Mutation 'R6663:Zfp668'
ID526874
Institutional Source Beutler Lab
Gene Symbol Zfp668
Ensembl Gene ENSMUSG00000049728
Gene Namezinc finger protein 668
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127863047-127876828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127867769 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 212 (R212C)
Ref Sequence ENSEMBL: ENSMUSP00000101870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054415] [ENSMUST00000106261] [ENSMUST00000106262] [ENSMUST00000106263] [ENSMUST00000144721]
Predicted Effect probably damaging
Transcript: ENSMUST00000054415
AA Change: R212C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056105
Gene: ENSMUSG00000049728
AA Change: R212C

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106261
AA Change: R212C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101868
Gene: ENSMUSG00000049728
AA Change: R212C

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106262
AA Change: R212C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101869
Gene: ENSMUSG00000049728
AA Change: R212C

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106263
AA Change: R212C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101870
Gene: ENSMUSG00000049728
AA Change: R212C

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144721
SMART Domains Protein: ENSMUSP00000116730
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
Meta Mutation Damage Score 0.2719 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Zfp668
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Zfp668 APN 7 127867907 missense probably damaging 1.00
IGL01063:Zfp668 APN 7 127866282 missense probably damaging 1.00
IGL01909:Zfp668 APN 7 127866822 missense probably damaging 1.00
IGL02404:Zfp668 APN 7 127866360 missense probably damaging 1.00
IGL02543:Zfp668 APN 7 127868322 nonsense probably null
IGL02946:Zfp668 APN 7 127866518 missense possibly damaging 0.70
R0078:Zfp668 UTSW 7 127868038 missense possibly damaging 0.94
R1521:Zfp668 UTSW 7 127867080 missense probably benign 0.09
R1775:Zfp668 UTSW 7 127866606 missense possibly damaging 0.75
R1873:Zfp668 UTSW 7 127866482 splice site probably null
R1875:Zfp668 UTSW 7 127866482 splice site probably null
R2066:Zfp668 UTSW 7 127867031 missense probably damaging 0.98
R2068:Zfp668 UTSW 7 127866665 missense probably benign 0.06
R2278:Zfp668 UTSW 7 127866826 missense probably benign 0.05
R5516:Zfp668 UTSW 7 127867146 missense probably damaging 1.00
R5569:Zfp668 UTSW 7 127867823 nonsense probably null
R5875:Zfp668 UTSW 7 127866302 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CGACTCCAAATACTGCCTGG -3'
(R):5'- ACTAAAGATCCACCAGCGTG -3'

Sequencing Primer
(F):5'- AAAGCCTTGCCTGCTCTCAG -3'
(R):5'- CACCAGCGTGGGCACAC -3'
Posted On2018-07-23