Incidental Mutation 'R6663:Zufsp'
ID526876
Institutional Source Beutler Lab
Gene Symbol Zufsp
Ensembl Gene ENSMUSG00000039531
Gene Namezinc finger with UFM1-specific peptidase domain
Synonyms2700019D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location33919142-33951269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33949435 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 17 (M17T)
Ref Sequence ENSEMBL: ENSMUSP00000151455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048222] [ENSMUST00000218055] [ENSMUST00000218222] [ENSMUST00000218275] [ENSMUST00000218880] [ENSMUST00000218892] [ENSMUST00000219457] [ENSMUST00000219878]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048222
AA Change: M17T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037121
Gene: ENSMUSG00000039531
AA Change: M17T

DomainStartEndE-ValueType
ZnF_C2H2 2 24 5.42e-2 SMART
ZnF_C2H2 29 52 1.13e1 SMART
ZnF_C2H2 153 176 2.47e1 SMART
ZnF_C2H2 192 214 6.23e-2 SMART
coiled coil region 236 267 N/A INTRINSIC
Pfam:Peptidase_C78 334 550 1.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218055
AA Change: M17T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218222
AA Change: M17T

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218275
AA Change: M17T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000218880
AA Change: M17T

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218892
AA Change: M17T

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219457
AA Change: M17T

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219878
AA Change: M17T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.6028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Other mutations in Zufsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Zufsp APN 10 33930154 critical splice donor site probably null
IGL02586:Zufsp APN 10 33935265 intron probably benign
IGL03350:Zufsp APN 10 33928111 missense probably benign 0.04
R0145:Zufsp UTSW 10 33943713 missense probably damaging 0.96
R1156:Zufsp UTSW 10 33949226 missense probably benign 0.15
R1523:Zufsp UTSW 10 33927440 missense probably damaging 1.00
R1769:Zufsp UTSW 10 33935176 missense probably damaging 1.00
R1802:Zufsp UTSW 10 33943718 missense probably damaging 0.98
R2013:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2014:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2015:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2017:Zufsp UTSW 10 33927464 missense possibly damaging 0.46
R2342:Zufsp UTSW 10 33928117 missense probably damaging 1.00
R2901:Zufsp UTSW 10 33927612 missense probably damaging 1.00
R2901:Zufsp UTSW 10 33928063 missense probably benign
R3813:Zufsp UTSW 10 33940222 missense possibly damaging 0.63
R4488:Zufsp UTSW 10 33948964 missense probably damaging 1.00
R4674:Zufsp UTSW 10 33948984 missense possibly damaging 0.92
R4883:Zufsp UTSW 10 33949042 missense probably damaging 0.98
R4926:Zufsp UTSW 10 33949438 missense probably damaging 1.00
R5163:Zufsp UTSW 10 33949443 missense probably damaging 1.00
R5373:Zufsp UTSW 10 33927466 missense possibly damaging 0.46
R5374:Zufsp UTSW 10 33927466 missense possibly damaging 0.46
R5924:Zufsp UTSW 10 33927547 missense probably damaging 0.96
R5929:Zufsp UTSW 10 33949047 nonsense probably null
R5941:Zufsp UTSW 10 33949462 missense probably damaging 1.00
R6337:Zufsp UTSW 10 33949256 missense probably benign 0.00
R6753:Zufsp UTSW 10 33928029 missense probably damaging 1.00
R7690:Zufsp UTSW 10 33930155 critical splice donor site probably null
R7772:Zufsp UTSW 10 33921702 splice site probably null
R7836:Zufsp UTSW 10 33919319 missense unknown
R7919:Zufsp UTSW 10 33949112 missense possibly damaging 0.92
R8054:Zufsp UTSW 10 33940252 missense probably damaging 1.00
X0063:Zufsp UTSW 10 33943687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTCTGAATGTCCATATTGCAC -3'
(R):5'- CCTGTAGCTAGGCTTTCTTAGG -3'

Sequencing Primer
(F):5'- GAATGTCCATATTGCACTGCAGC -3'
(R):5'- CAGTGAATTTTTCTTTGCCAAAGC -3'
Posted On2018-07-23