Incidental Mutation 'R6663:Pln'
ID526877
Institutional Source Beutler Lab
Gene Symbol Pln
Ensembl Gene ENSMUSG00000038583
Gene Namephospholamban
SynonymsPLB
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6663 (G1)
Quality Score100.008
Status Validated
Chromosome10
Chromosomal Location53337667-53345987 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 53343696 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046221] [ENSMUST00000095691] [ENSMUST00000163319] [ENSMUST00000218468] [ENSMUST00000219491] [ENSMUST00000219921] [ENSMUST00000220197] [ENSMUST00000220376] [ENSMUST00000220443]
Predicted Effect probably benign
Transcript: ENSMUST00000046221
SMART Domains Protein: ENSMUSP00000045709
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095691
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163319
SMART Domains Protein: ENSMUSP00000132743
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218351
Predicted Effect probably benign
Transcript: ENSMUST00000218468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218596
Predicted Effect probably benign
Transcript: ENSMUST00000219491
Predicted Effect probably benign
Transcript: ENSMUST00000219921
Predicted Effect probably benign
Transcript: ENSMUST00000220197
Predicted Effect probably benign
Transcript: ENSMUST00000220376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220401
Predicted Effect probably benign
Transcript: ENSMUST00000220443
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced myocardial function without altered heart rate, but do not respond to the beta-agonist isoproterenol. Mutants are overtly normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Pln
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7233:Pln UTSW 10 53343912 missense probably damaging 0.99
R7761:Pln UTSW 10 53343909 missense probably damaging 0.99
R8060:Pln UTSW 10 53343897 missense unknown
R8307:Pln UTSW 10 53343879 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCAAGTGGCTAGAATCTGC -3'
(R):5'- GAGCGAGTGAGGTATTGCAC -3'

Sequencing Primer
(F):5'- TTGTGTTTACAGAGAAACAGAGC -3'
(R):5'- CACTTTTTCCATTATGCCAGGAAGG -3'
Posted On2018-07-23