Incidental Mutation 'R6663:Nkx2-9'
ID526878
Institutional Source Beutler Lab
Gene Symbol Nkx2-9
Ensembl Gene ENSMUSG00000058669
Gene NameNK2 homeobox 9
SynonymsNkx2.9, Nkx-2.9, tinman
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6663 (G1)
Quality Score84.0076
Status Validated
Chromosome12
Chromosomal Location56611389-56613284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56611938 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 164 (R164S)
Ref Sequence ENSEMBL: ENSMUSP00000072425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072631]
Predicted Effect probably benign
Transcript: ENSMUST00000072631
AA Change: R164S

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072425
Gene: ENSMUSG00000058669
AA Change: R164S

DomainStartEndE-ValueType
HOX 81 143 5.04e-23 SMART
low complexity region 162 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191707
Meta Mutation Damage Score 0.4954 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing developmental regulator associated with liver development. The encoded protein binds to the alpha-fetoprotein (AFP) gene promoter and increases the expression of AFP. This gene is overexpressed in some lung cancers and is linked to poor patient survival, possibly due to its resistance to cisplatin. This gene is aberrantly methylated in pancreatic cancer, deleted in squamous cell lung carcinomas, and acts as a tumor suppressor in esophageal cancer. Mutations in this gene may also be a cause of neural tube defects. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutant mice lacking both functional copies of the gene are viable and fertile but display abnormal development of the spinal accessory nerve. Another mutant exhibits progressive bronchial dysplasia leading to lung cancer in aged mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Med6 T A 12: 81,581,875 D80V possibly damaging Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Nkx2-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Nkx2-9 APN 12 56611920 missense probably damaging 1.00
R1633:Nkx2-9 UTSW 12 56612981 missense probably benign 0.01
R2349:Nkx2-9 UTSW 12 56612222 missense probably benign 0.00
R6872:Nkx2-9 UTSW 12 56611889 missense probably benign
R7804:Nkx2-9 UTSW 12 56612132 missense probably damaging 1.00
R7898:Nkx2-9 UTSW 12 56612246 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAAGTCTAGGGTGGCTTTAGG -3'
(R):5'- AGAATTGGGACTCCAGGTGG -3'

Sequencing Primer
(F):5'- TTTAGGCACTCCGCAGCAG -3'
(R):5'- TGTTCTCCAAGGCCCAGAC -3'
Posted On2018-07-23