Incidental Mutation 'R6663:Med6'
ID526879
Institutional Source Beutler Lab
Gene Symbol Med6
Ensembl Gene ENSMUSG00000002679
Gene Namemediator complex subunit 6
Synonyms1500012F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6663 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81573557-81595008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81581875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 80 (D80V)
Ref Sequence ENSEMBL: ENSMUSP00000002756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002756] [ENSMUST00000161211] [ENSMUST00000161598] [ENSMUST00000161902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002756
AA Change: D80V

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002756
Gene: ENSMUSG00000002679
AA Change: D80V

DomainStartEndE-ValueType
Pfam:Med6 1 90 9.6e-32 PFAM
low complexity region 165 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159187
Predicted Effect probably benign
Transcript: ENSMUST00000161211
AA Change: D131V

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125156
Gene: ENSMUSG00000002679
AA Change: D131V

DomainStartEndE-ValueType
Pfam:Med6 13 140 1.8e-46 PFAM
low complexity region 216 227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161598
AA Change: D131V

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124361
Gene: ENSMUSG00000002679
AA Change: D131V

DomainStartEndE-ValueType
Pfam:Med6 13 141 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161902
AA Change: D80V

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125103
Gene: ENSMUSG00000002679
AA Change: D80V

DomainStartEndE-ValueType
Pfam:Med6 1 90 3.4e-32 PFAM
Meta Mutation Damage Score 0.1935 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 A G 5: 90,264,064 S1314P probably damaging Het
Btbd3 T A 2: 138,279,083 I59K probably benign Het
Clcn2 A G 16: 20,703,245 *865R probably null Het
Col22a1 T C 15: 71,820,059 Q749R unknown Het
Cpsf2 T C 12: 101,999,593 Y606H probably damaging Het
Csn1s1 T C 5: 87,675,740 V154A probably benign Het
Cux1 T A 5: 136,485,847 E23V probably damaging Het
Cyp2j9 C A 4: 96,579,442 W269L probably benign Het
Dbf4 T C 5: 8,403,184 M273V probably benign Het
Dnhd1 A G 7: 105,685,692 probably null Het
Fezf1 A G 6: 23,247,528 S183P probably damaging Het
Irx2 A G 13: 72,629,129 Y23C probably damaging Het
Itga1 A T 13: 114,974,105 N983K probably benign Het
Kifc1 A G 17: 33,881,456 probably benign Het
Lrrc14b T C 13: 74,361,361 N309S probably damaging Het
Lyst A T 13: 13,664,116 probably null Het
Map1b T C 13: 99,430,022 T2064A unknown Het
Mark3 T A 12: 111,575,083 N11K probably benign Het
Mfhas1 A G 8: 35,589,118 E249G probably damaging Het
Mroh2b A G 15: 4,947,935 I1256M probably benign Het
Nkx2-9 G T 12: 56,611,938 R164S probably benign Het
Olfr1181 T A 2: 88,423,350 N225I probably benign Het
Phf10 T C 17: 14,959,512 D33G probably null Het
Plekha5 A G 6: 140,577,290 M719V probably damaging Het
Pln A G 10: 53,343,696 probably benign Het
Prg4 G A 1: 150,455,101 probably benign Het
Slc35b3 A G 13: 38,954,136 L99P probably damaging Het
Tbccd1 AT ATGT 16: 22,834,028 probably null Het
Ube2j1 C T 4: 33,045,198 S157L probably damaging Het
Zfp462 A G 4: 55,008,933 T300A possibly damaging Het
Zfp668 G A 7: 127,867,769 R212C probably damaging Het
Zufsp A G 10: 33,949,435 M17T possibly damaging Het
Other mutations in Med6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Med6 APN 12 81579574 missense possibly damaging 0.95
R0607:Med6 UTSW 12 81589024 missense probably damaging 1.00
R2020:Med6 UTSW 12 81573877 missense probably benign
R3946:Med6 UTSW 12 81581851 missense probably damaging 1.00
R4763:Med6 UTSW 12 81582661 missense probably damaging 1.00
R5640:Med6 UTSW 12 81581854 missense probably damaging 1.00
R5772:Med6 UTSW 12 81579644 missense probably damaging 1.00
R5786:Med6 UTSW 12 81573959 missense probably null 0.00
R6049:Med6 UTSW 12 81591323 missense probably damaging 1.00
R6886:Med6 UTSW 12 81591385 missense probably damaging 1.00
R7127:Med6 UTSW 12 81589000 missense probably damaging 0.97
R7919:Med6 UTSW 12 81573847 nonsense probably null
R8158:Med6 UTSW 12 81573903 missense probably benign 0.00
R8506:Med6 UTSW 12 81594960 start codon destroyed probably null 0.14
Predicted Primers PCR Primer
(F):5'- CGCAATGCCATCACCTTCTG -3'
(R):5'- TGAGTCTGCCTGAATAACTACAGTC -3'

Sequencing Primer
(F):5'- GCCATCACCTTCTGAAAAATTAAAAC -3'
(R):5'- ATCCCTTGCAGATACTGAAGG -3'
Posted On2018-07-23